Preparation method of recombination human thymosin beta 16

A thymosin and recombinant protein technology, applied in the field of bioengineering, can solve the problems of environmental pollution and high cost, and achieve the effects of broad application prospects, long duration of action, and simple structure

Inactive Publication Date: 2009-12-16
FILLDERM (CHANGCHUN) MEDICINE BIOLOGY TECH CO LTD
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the chemical synthesis method is costly and easy to cause environmental pollution.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of recombination human thymosin beta 16
  • Preparation method of recombination human thymosin beta 16
  • Preparation method of recombination human thymosin beta 16

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1: pET / SUMO-Tβ16 fusion protein gene and its expression in Escherichia coli

[0053] 1. Reagents and materials

[0054] The vector plasmid pET3c was donated by the Engineering Research Center of the Ministry of Education for Bioreactor and Drug Development, the BL21 (DE3) strain was preserved by our laboratory, His, SUMO, and Tβ16 genes were synthesized by Shanghai Bioengineering Co., Ltd., and the DNA rapid purification / recovery kit was purchased from Beijing Dingguo Biotechnology Co., Ltd., e.z.N.A TM Plasmid Mini Kit I (100) plasmid extraction kit was purchased from OMEGA bio-tek company, Taq DNA polymerase, T 4 DNA ligase and restriction enzymes Nde I and BamH I were purchased from Bao Biological Engineering (Dalian) Co., Ltd.

[0055] 2. Method

[0056] 2.1 Design and synthesis of oligonucleotide primers:

[0057] The DNA sequences of SUMO and Tβ16 were designed with Escherichia coli preferred codons, the upstream primers contained Nde I restriction ...

Embodiment 2

[0076] Example 2: pGEX / GST-Tβ16 fusion protein gene and its expression in Escherichia coli

[0077] 1. Reagents and materials

[0078] The vector plasmid pGEX-6P-1 was donated by the Department of Agriculture of Jilin University, the BL21(DE3) strain was preserved by our laboratory, His, SUMO, and Tβ16 genes were synthesized by Shanghai Bioengineering Co., Ltd., and the DNA rapid purification / recovery kit was purchased from Beijing Dingguo Biotechnology Technology LLC, e.z.N.A TM Plasmid Mini Kit I (100) plasmid extraction kit was purchased from OMEGAbio-tek company, Taq DNA polymerase, T 4 DNA ligase and restriction enzymes EcoR I and Sal I were purchased from Bao Biological Engineering (Dalian) Co., Ltd.

[0079] 2. Method

[0080] 2.1 Design and synthesis of oligonucleotide primers:

[0081] The DNA sequences of SUMO and Tβ16 were designed with Escherichia coli preferred codons, the upstream primers contained EcoR I restriction sites, and the downstream primers contained ...

Embodiment 3

[0100] Example 3: pTW-Tβ16 fusion protein gene and its expression in Escherichia coli

[0101] 1. Reagents and materials

[0102] The vector plasmid pTWIN1, the expression strain E.coli ER2566, the endonuclease Sap I and chitin were purchased from NEB Company; the Tβ16 gene was synthesized by Shanghai Bioengineering Co., Ltd., and the DNA rapid purification / recovery kit was purchased from Beijing Dingguo Biotechnology Co., Ltd. Responsible Company, e.z.N.A TM Plasmid Mini Kit I (100) plasmid extraction kit was purchased from OMEGAbio-tek company, Taq DNA polymerase, T 4 DNA ligase was purchased from Bao Biological Engineering (Dalian) Co., Ltd.

[0103] 2. Method

[0104] 2.1 Design and synthesis of oligonucleotide primers:

[0105] The DNA sequence of Tβ16 was designed with E. coli preferred codons as follows:

[0106]

PF (on)

5′-AACATGAGTGATAAGC-3′

F

ATGAGTGATAAGCCAGATCTTAGTGAAGTTGAAAAAGAA

F2

TTAGTGAAGTTGAAAAAGAAGATCGCAGTAAGCTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method of recombination human thymosin beta 16, belonging to the field of biological engineering. The invention aims at adopting a genetic engineering technology to prepare the recombination human thymosin beta 16. The recombination human thymosin beta 16 has an amino acid sequence: SEQ ID NO: 1. The T beta 16 is used as one of thymosin family members, has a wound healing promoting function different from the same-effect medicines applied to a market or in a developing process. The T beta 16 is not a growth factor. Compared with various growth factors, the T beta 16 has multiple advantages for healing wounds.

Description

Technical field: [0001] The invention belongs to the field of biological engineering. Background technique: [0002] Thymosin is a general term for a family of polypeptides that widely exist in humans and animals. These small molecular polypeptides are composed of 40-45 amino acids, and the sequences among family members are highly conserved. Most of them have a molecular weight of about 5kDa, and they are a kind of polar polypeptide molecules. [0003] Thymosin can be divided into α-type, β-type and γ-type according to the isoelectric point difference of family members. Among them, due to their important roles in various physiological and biochemical processes, the functions and mechanisms of β-type family members have gradually become one of the research hotspots in recent years. Thymosin β4 chemically synthesized abroad has entered phase II clinical application in corneal repair, skin burns, and ulcer repair. However, the chemical synthesis method is costly and easy to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/66C07K19/00C12N15/70C12N15/62C12N15/16C12N15/81C12N1/21C12N1/19A61K38/32A61P17/02A61P27/02
Inventor朱迅冯秀萍杜柏榕马威
OwnerFILLDERM (CHANGCHUN) MEDICINE BIOLOGY TECH CO LTD