Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof
A Chinese honeybee and antibacterial peptide technology, applied in the field of genetic engineering, can solve the problem of no preservative additives, and achieve the effect of preventing food-borne bacterial contamination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: Cloning and determination of the antimicrobial peptide AccRoyalisin gene of Apis mellifera royal jelly
[0042] 1. cDNA library construction
[0043] The worker bees that emerged on the same day were marked with a paint pen, recaptured at 1, 3, 4, 5, 7, 9, 12, 15, 18, 21, 24, 27 and 30 days of age, and stored at -80°C. Take 10 heads from each day-old worker bee sample, add liquid nitrogen to homogenate, add TRIZOL to extract total RNA. The mRNA was purified step by step with the kit, and the first and second strands of cDNA were synthesized. Then use end-filling enzyme to fill in the double-stranded cDNA end, add EcoRI linker and phosphorylate it, and then digest it with Xho I. The digested product is identified by agarose gel electrophoresis, and then MinElute Gel Extraction kit Perform gel recovery.
[0044] Connect the cDNA to the carrier pBluescript IISK(+), transform E.coli DH10B competent bacteria by electroshock reaction method, add SOC medium, reco...
Embodiment 2
[0056] Example 2, the cloning of the antimicrobial peptide AccRoyalisin mature peptide gene of Apis mellifera royal jelly and its expression in E. coli
[0057] In this example, the clone sequenced in Example 1 and having the complete AccRoyalisin precursor nucleotide sequence was used as a template, and a pair of oligonucleotides designed according to the AccRoyalisin mature peptide gene sequence were used as primers as primers. PCR amplification
[0058] The 5' oligonucleotide primer sequences used in the PCR reaction are:
[0059] The 5' end primer sequence Accr-f2 is: AGGATCCATGGTAACTTGTGACCTT (SEQ ID No.2), this primer contains the restriction endonuclease cutting site of BamHI, the translation initiation codon and the partial coding sequence of AccRoyalisin;
[0060] The 3' end primer sequence Acc-r1 is: 5'-GCGGCCGCTTAACCGAAACGTTTGTC-3' (SEQ ID No. 3). This primer contains a Not I restriction endonuclease cutting site, a translation terminator and the partial coding seq...
Embodiment 3
[0066] Example 3: antibacterial effect of antibacterial peptide AccRoyalisin mature peptide of Chinese bee royal jelly
[0067] After activating Staphylococcus aureus, Lactococcus aureus and Bacillus subtilis in the laboratory, single colonies were inoculated in LB medium and cultured at 37°C and 220r / min for 8 hours before taking out. The three strains were diluted 10 -5 、10 -6 、10 -7 、10 -8 、10 -9 、10 -10 After that, take 1 mL each and spread it on the bacterial medium plate, place it in an incubator and cultivate it for 16 hours, take a plate with the total number of colonies between 100-300, and read the total number of colonies.
[0068] The calculated concentrations of the three bacteria are: Bacillus subtilis is 1.5*10 8 cfu / mL, Lactococcus flavum 1.2*10 9 cfu / mL, Staphylococcus aureus 1.8*10 8 cfu / mL.
[0069] Dilute the three bacterial solutions with sterile water in proportion to 1.0*10 7 For each cfu / mL bacterial solution, 200 μL was spread on nutrient aga...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
