Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof

A Chinese honeybee and antibacterial peptide technology, applied in the field of genetic engineering, can solve the problem of no preservative additives, and achieve the effect of preventing food-borne bacterial contamination

Inactive Publication Date: 2010-05-12
ZHEJIANG UNIV
View PDF1 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But for Royalisin, in addition to reports of the Royalisin gene sequence and amino acid sequence of Apis mellifera, and the antibacterial test of Royalisin isolated from natural royal jelly, there is no Chinese honeybee Royalisin gene and polypeptide sequence at...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof
  • Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof
  • Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Cloning and determination of the antimicrobial peptide AccRoyalisin gene of Apis mellifera royal jelly

[0042] 1. cDNA library construction

[0043] The worker bees that emerged on the same day were marked with a paint pen, recaptured at 1, 3, 4, 5, 7, 9, 12, 15, 18, 21, 24, 27 and 30 days of age, and stored at -80°C. Take 10 heads from each day-old worker bee sample, add liquid nitrogen to homogenate, add TRIZOL to extract total RNA. The mRNA was purified step by step with the kit, and the first and second strands of cDNA were synthesized. Then use end-filling enzyme to fill in the double-stranded cDNA end, add EcoRI linker and phosphorylate it, and then digest it with Xho I. The digested product is identified by agarose gel electrophoresis, and then MinElute Gel Extraction kit Perform gel recovery.

[0044] Connect the cDNA to the carrier pBluescript IISK(+), transform E.coli DH10B competent bacteria by electroshock reaction method, add SOC medium, reco...

Embodiment 2

[0056] Example 2, the cloning of the antimicrobial peptide AccRoyalisin mature peptide gene of Apis mellifera royal jelly and its expression in E. coli

[0057] In this example, the clone sequenced in Example 1 and having the complete AccRoyalisin precursor nucleotide sequence was used as a template, and a pair of oligonucleotides designed according to the AccRoyalisin mature peptide gene sequence were used as primers as primers. PCR amplification

[0058] The 5' oligonucleotide primer sequences used in the PCR reaction are:

[0059] The 5' end primer sequence Accr-f2 is: AGGATCCATGGTAACTTGTGACCTT (SEQ ID No.2), this primer contains the restriction endonuclease cutting site of BamHI, the translation initiation codon and the partial coding sequence of AccRoyalisin;

[0060] The 3' end primer sequence Acc-r1 is: 5'-GCGGCCGCTTAACCGAAACGTTTGTC-3' (SEQ ID No. 3). This primer contains a Not I restriction endonuclease cutting site, a translation terminator and the partial coding seq...

Embodiment 3

[0066] Example 3: antibacterial effect of antibacterial peptide AccRoyalisin mature peptide of Chinese bee royal jelly

[0067] After activating Staphylococcus aureus, Lactococcus aureus and Bacillus subtilis in the laboratory, single colonies were inoculated in LB medium and cultured at 37°C and 220r / min for 8 hours before taking out. The three strains were diluted 10 -5 、10 -6 、10 -7 、10 -8 、10 -9 、10 -10 After that, take 1 mL each and spread it on the bacterial medium plate, place it in an incubator and cultivate it for 16 hours, take a plate with the total number of colonies between 100-300, and read the total number of colonies.

[0068] The calculated concentrations of the three bacteria are: Bacillus subtilis is 1.5*10 8 cfu / mL, Lactococcus flavum 1.2*10 9 cfu / mL, Staphylococcus aureus 1.8*10 8 cfu / mL.

[0069] Dilute the three bacterial solutions with sterile water in proportion to 1.0*10 7 For each cfu / mL bacterial solution, 200 μL was spread on nutrient aga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses an Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and an encoded polypeptide thereof and application thereof. The gene has a DNA sequence shown as SEQ ID No.4; and the encoded protein of the gene has an amino acid sequence shown as SEQ ID No.5. The antibacterial peptide gene can establish a high-expression genetic engineering strain by building an Escherichia coli expression vector, and performing producing and separating and purifying on a recombinant product through induction expression of the fermentation engineering. The recombinant product thereof has an obvious inhibiting effect on a plurality of gram positive bacteria, such as bacillus subtilis, staphylococcus aureus and micrococcus flavus and the like, can be used for preserving and refreshing foods, in particular for preventing food-born bacterial contamination, is harmless to human body and animals, can serve as a substitute of antibiotics and chemical preservatives and is also suitable for preventing and controlling bred animal bacterial diseases. The Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and the encoded polypeptide thereof lay a foundation for the development, the massive industrial production and the application of the Royalisin.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular, the invention relates to a Chinese honeybee (Apis ceranacerana) royal jelly antimicrobial peptide AccRoyalisin gene and its coded polypeptide. More specifically, the present invention relates to the cDNA sequence of the AccRoyalisin gene, the AccRoyalisin encoded by the cDNA sequence is a homologue of the Apis mellifera AmRoyalisin polypeptide, and the post-translationally processed polypeptide of the AccRoyalisin is a homolog of the Apis mellifera AmRoyalisin polypeptide thing. The present invention also relates to the polypeptide encoded by the nucleotide sequence, the application of the nucleotide and the polypeptide, and the preparation method of the nucleotide and the polypeptide. Background technique [0002] Royal jelly is a biologically active substance secreted by the royal jelly glands on the head of bees. It has a long history as a nutritional health product for human...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C07K14/435C07K16/18A61K38/17A61P31/04
Inventor 沈立荣丁美会金凤张伟光张瑮文
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap