Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof
A technology of influenza virus and kit, applied in biochemical equipment and methods, microbiological measurement/inspection, fluorescence/phosphorescence, etc., can solve the problems of sample contamination, high false positive rate, wrong results, etc., and achieve high sensitivity, The effect of simple and convenient operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] A method for rapid detection of influenza A H1N1 influenza virus nucleic acid at constant temperature, the steps are as follows:
[0024] a. Prepare specific detection primers, use bioinformatics knowledge and relevant bioinformatics software to perform homology comparisons on all influenza A H1N1 influenza hemagglutinin (HA) gene nucleic acid sequences that can be retrieved in the existing nucleic acid database, according to Conservative sequence design primers, add T7 promoter sequence (underlined part) to the 5' end of the reverse primer to obtain specific detection primers, as follows:
[0025] Forward SW HA P2
[0026] 5'-ATTCACCATCATCTACTAG-3'
[0027] Reverse SW H1 P1
[0028] 5'- AATTCTAATACGACTCACTATAGGG GTCCAGTAATAGTTCATTCTC-3',
[0029] All primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.;
[0030] b. Design specific detection probes, using bioinformatics knowledge and related biological
[0031] The informatics s...
Embodiment 2
[0045] Utilize the method of the present invention to prepare a kind of constant temperature real-time detection kit of influenza A (H1N1) virus nucleic acid fast detection, its preparation method is identical with the method for conventional preparation kit, repeats no more here, difference is: in this kit It includes 11ul of constant temperature amplification reaction solution containing primer probe and 7ul of enzyme mixture composed of AMV reverse transcriptase, T7 RNA polymerase and nuclease H. Wherein the amplification reaction solution contains 40mM tris-hydrochloric acid (pH 8.5), 12mM magnesium chloride, 70mM potassium chloride, 5mM dithiothreitol 1, 1mM deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 0.5-2mM nucleotide triphosphate (ATP, CTP, UTP, GTP, ITP), 15% (vol / vol) dimethyl sulfoxide, 0.6 μM specific detection primer, 0.2 μM specific detection probe Needle. The enzyme mix is 0.1U of Nuclease H, 40U of T7 RNA Polymerase and 8U of AMV Reverse Transcrip...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 