Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof

A technology of influenza virus and kit, applied in biochemical equipment and methods, microbiological measurement/inspection, fluorescence/phosphorescence, etc., can solve the problems of sample contamination, high false positive rate, wrong results, etc., and achieve high sensitivity, The effect of simple and convenient operation

Inactive Publication Date: 2010-09-29
JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method has high detection sensitivity and simple operation, but has the disadvantages of sample contamination, high false positive rate, etc., resulting in wrong results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof
  • Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof
  • Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] A method for rapid detection of influenza A H1N1 influenza virus nucleic acid at constant temperature, the steps are as follows:

[0024] a. Prepare specific detection primers, use bioinformatics knowledge and relevant bioinformatics software to perform homology comparisons on all influenza A H1N1 influenza hemagglutinin (HA) gene nucleic acid sequences that can be retrieved in the existing nucleic acid database, according to Conservative sequence design primers, add T7 promoter sequence (underlined part) to the 5' end of the reverse primer to obtain specific detection primers, as follows:

[0025] Forward SW HA P2

[0026] 5'-ATTCACCATCATCTACTAG-3'

[0027] Reverse SW H1 P1

[0028] 5'- AATTCTAATACGACTCACTATAGGG GTCCAGTAATAGTTCATTCTC-3',

[0029] All primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.;

[0030] b. Design specific detection probes, using bioinformatics knowledge and related biological

[0031] The informatics s...

Embodiment 2

[0045] Utilize the method of the present invention to prepare a kind of constant temperature real-time detection kit of influenza A (H1N1) virus nucleic acid fast detection, its preparation method is identical with the method for conventional preparation kit, repeats no more here, difference is: in this kit It includes 11ul of constant temperature amplification reaction solution containing primer probe and 7ul of enzyme mixture composed of AMV reverse transcriptase, T7 RNA polymerase and nuclease H. Wherein the amplification reaction solution contains 40mM tris-hydrochloric acid (pH 8.5), 12mM magnesium chloride, 70mM potassium chloride, 5mM dithiothreitol 1, 1mM deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 0.5-2mM nucleotide triphosphate (ATP, CTP, UTP, GTP, ITP), 15% (vol / vol) dimethyl sulfoxide, 0.6 μM specific detection primer, 0.2 μM specific detection probe Needle. The enzyme mix is ​​0.1U of Nuclease H, 40U of T7 RNA Polymerase and 8U of AMV Reverse Transcrip...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fast detection method of nucleic acid of A H1N1 influenza virus, and a kit thereof, belonging to the technical field biotechnology. The invention provides a fast and synthermal RNA amplification method of A H1N1 influenza virus, and the accomplishment of the entire reaction depends on the cooperation of the AMV reverse transcriptase, the T7RNA polymerase and nuclease H (RNaseH), without the needs of the special instruments and the temperature cycling, the amplification efficiency is larger than or equal to that of the PCR, and the reaction product is single stranded RNA. The invention has the advantages of having equal or higher sensibility than that of the RT-PCR detection method, avoiding the pollution problem of the RT-PCR amplification product due to that the amplification product is RNA, finishing the reaction in one hour, and simple and convenient operation. The reaction can be monitored in real time and detected by the end-point method, can be used as the important tool in the detection of A H1N1 influenza virus.

Description

technical field [0001] The invention relates to a method and a kit for detecting viral nucleic acid, belonging to the field of biotechnology. Background technique [0002] In March 2009, a "human-infected swine flu" epidemic broke out in Mexico, resulting in deaths. On June 11, the World Health Organization (hereinafter referred to as WHO) announced that the influenza pandemic warning level was raised to the highest level 6, which means the arrival of a new round of influenza pandemic. Studies have found that the pathogen of this outbreak is a mutated new type A H1N1 influenza virus, which contains gene fragments of three influenza viruses: swine flu, bird flu and human flu, and can be transmitted among humans. The WHO initially called the influenza outbreak "human-infected swine flu", but with an in-depth understanding of the nature of the outbreak, it has now been renamed "Influenza A H1N1". The Ministry of Health of my country announced on April 30 that it will be inclu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64
Inventor 崔仑标葛以跃史智扬祁贤郭喜玲赵康辰单军单云峰戚宇华汪华
Owner JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com