Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Engineering bacterium containing 2-ketoglutarate decarboxylase gene kgd and application thereof

A technology of engineering bacteria and genes, applied in the field of genetic engineering technology and fermentation, can solve the problems of high price, high cytotoxicity, cumbersome and complicated mixed carbon source fermentation strategy, etc., and achieve the effect of reducing production costs

Inactive Publication Date: 2010-12-08
TIANJIN GREENBIO MATERIAL CO LTD
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The structure of 4HB is similar to that of carbon sources, which are very expensive and highly toxic to cells. During the fermentation process, it is often necessary to add feed in batches, and the fermentation strategy of mixed carbon sources is also cumbersome and complicated.
For example, 4-hydroxybutyric acid is considered to be the most effective carbon source for incorporation of 4HB monomer into copolyesters, but it is a controlled drug in our country and it is difficult to buy it in the market in the form of chemicals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium containing 2-ketoglutarate decarboxylase gene kgd and application thereof
  • Engineering bacterium containing 2-ketoglutarate decarboxylase gene kgd and application thereof
  • Engineering bacterium containing 2-ketoglutarate decarboxylase gene kgd and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, construction plasmid pBHR68orfZ

[0042] 1. Double cut plasmid pCK3 with ClaI and EcoRI ( B, Gott schalk G. Mol ecular analysis of the anaerobic succinate degradation pathway in Clostridium kluyveri. J Bacteriol, 1996, 178: 871-880), a 1.8 kb fragment was recovered from the gel, containing the orfZ gene and its promoter sequence.

[0043] 2. Double cut plasmid pBHR68 with ClaI and EcoRI (Spiekermann P, Rehm BHA, Kalscheuer R, et al. A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch Microbiol, 1999, 171:73-80), the gel recovered a fragment of 8.1 kb, which contained the phaCAB gene and its promoter sequence, the Amp resistance gene and replicon derived from pBluescript II SK (-).

[0044] 3. Use T4 DNA ligase to ligate the fragments recovered in step 1 and step 2; after the ligation reaction is completed, plasmid pBHR68orfZ is obtaine...

Embodiment 2

[0046] Embodiment 2, construction plasmid pMCS4HB

[0047] 1. Contains pyruvate decarboxylase promoter (referred to as P pdc ) construction of expression vector pPpdc

[0048]人工合成一段双链DNA,其序列如下所示:5′-tgataagaattccctaggactagtttacgctcatgatcgcggcatgtcctgatatttttcctctaaaaaagataaaaagtcttttcgcttcggcagaagaggttcatcatgaacaaaaattcggcatttttaaaaatgcctatagctaaatccggaacgacactttagaggtttctgggtcatcctgattcagacatagtgttttgaatataggatccgagctcaagcttagatctggtacctctagacgcccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttcctgt

[0049] It contains a pyruvate decarboxylase promoter sequence from Mobilemonas, a multiple cloning site, and a transcription termination sequence. It was connected to T vector pMD19-T Simple (purchased from Japan Takara Company) by TA cloning method to obtain expression vector pPpdc.

[0050] 2. Cloning of 4hbD gene and construction of expression vector pPpdc4hbD

[0051] 1) Under standard polymerase chain reaction conditions, the plasmid pCK3 ( B...

Embodiment 3

[0069] Example 3 Construction of plasmid pMCS4HBRE

[0070] 1. Double cut plasmid pCK3 with ClaI and EcoRI ( B, Gottschalk G. Molecular analysis of the anaerobic succinate degradation pathway in Clostridium kluyveri. J Bacteriol, 1996, 178: 871-880), a 1.8 kb fragment was recovered from the gel, containing the orfZ gene and its promoter sequence.

[0071] 2. The plasmid vector pBBR1MCS-2 (NCBI GenBank No. U23751) was double cut with ClaI and EcoRI to obtain a 5.1 kb DNA fragment as a vector.

[0072] 3. Use T4 DNA ligase to ligate the fragments recovered in step 1 and step 2; after the ligation reaction is completed, the plasmid pMCSorfZ is obtained. Introduced into E.coli JM109 (purchased from China General Microorganism Culture Collection Management Center) by electroporation, spread on LB-Km solid medium, and cultured at 37°C for 16h;

[0073] 4. Pick a single clone from LB-Km solid medium into LB-Km liquid medium, culture for 16h (37°C shaker, 200rpm), extract the plasm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of a gene engineering technology and a fermentation technology, in particular to an engineering bacterium which contains 2-ketoglutarate decarboxylase gene kgd and is used for producing 3-hydroxybutyrate and 4-hydroxy acid copolyester by utilizing a carbohydrate carbon source. Single carbohydrate carbon source with relative low price can be used to produce P3HB4HB by utilizing the engineering bacterium to effectively decrease the production cost thereof and propel the mass industrialized production and the commercial application development thereof.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and fermentation technology, and more specifically relates to a 2-oxoglutarate decarboxylase gene kgd that uses sugar carbon sources to produce 3-hydroxybutyric acid and 4-hydroxybutyric acid copolyesters Engineering bacteria and its application. Background technique [0002] Polyhydroxyalkanoates (polyhydroxyalkanoates, referred to as PHA) is a class of polymer biopolyesters widely present in microorganisms, mainly as carbon sources and energy storage substances in cells (Anderson AJ, Dawes EA. Occurrence, metabolism, metabolic role, and industrial use of bacterial polyhydroxyalkanoates. Microbiol Rev, 1990, 54: 450-472). 3-hydroxybutyric acid and 4-hydroxybutyric acid copolyester [poly(3-hydroxybutyrate-co-4-hydroxybutyrate), referred to as P3HB4HB] is a member of the PHA family (molecular formula I), which was first formed by Doi Y equal to Discovered in Ralstonia eutropha in 198...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/74C12P7/62C12R1/01C12R1/19
Inventor 陈国强吕渭川周子振
Owner TIANJIN GREENBIO MATERIAL CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com