Fenneropenaeus chinensis ubiquitin-conjugating enzyme gene and ubiquitin-conjugating enzyme coded by same and application
A technology of ubiquitin ligase and penaeus prawn is applied in the field of genetic engineering, and can solve the problems such as no reports of ubiquitin ligase gene and application.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Embodiment 1: the cloning of ubiquitin ligase cDNA of Chinese penaeus prawn
[0068] 1) Extraction of total RNA: Total RNA was extracted by one-step method using the prior art.
[0069] 2) cDNA first-strand synthesis: 4 microliters of total RNA, plus 1 microliter of SmartF (5'-TAC GGC TGC GAG AAGACG ACA GAA GGG-3') and 1 microliter of Oligoanchor R (5'-GAC CAC GCG TAT CGA TGT CGACT16(A / C / G)-3'), react at 72°C for 5 minutes, then add 4 microliters of 5-fold Buffer, 1.25 microliters of dNTP, 0.625 microliters of RNase inhibitor, and 1 microliter of M-MLV reverse transcription Enzyme, 12.875 microliters of RNase-free sterilized water, react at 42°C for 60 minutes, and stop the reaction at 70°C for 10 minutes.
[0070] 3) Rapid amplification of cDNA 3' end of ubiquitin ligase in Penaeus chinensis
[0071] According to the conserved sequence of ubiquitin ligase in other species, the degenerate primer F1 was designed, and the 3' end of ubiquitin ligase was amplified by PCR ...
Embodiment 2
[0092] Example 2: Construction, expression and purification of prokaryotic recombinant expression vectors
[0093] (1) According to the sequence of the ubiquitin ligase of Penaeus prawn and the cloning site of the expression vector pET30a (Novagen Company), design primers:
[0094] FcUbc ExF: 5′TACTCA GAATTC ATGACGGCACTGCAGAGAATA 3′ (EcoR I)
[0095] FcUbc ExR: 5′ TACTCA CTCGAG CGTGAGCATAGAAGGAAGGAA 3′ (Xho I)
[0096] The present invention selects the EcoR I and Xho I restriction sites of the pET30a cloning site. Therefore, when designing the primers, the EcoR I restriction site is introduced into the upstream primer, and the Xho I restriction site is introduced into the downstream primer.
[0097] (2) Gene amplification, cloning and recombinant plasmid screening
[0098] Hepatopancreas cDNA was used as a template, and the above primers were used for PCR reaction. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 30s, 55°C, 45s, 72°C, 45s, 35 cycle...
Embodiment 3
[0106] Example 3: The Ubiquitin Ligase Recombinant Protein of Chinese Penaeus prawn has antiviral function
[0107] (1) Qualitative analysis of the antiviral effect of FcUbc by semi-quantitative PCR
[0108] Japanese prawns (Marsupenaeus japonicus) were divided into four groups, and Tris-HCl, WSSV, HaGK+WSSV and FcUbc+WSSV were injected into the membrane between the abdominal segment and telson respectively. The concentration of FcUbc is 20 μg / mL, and the concentration of WSSV is 3.2*10 5 / ml, the total injection volume of each shrimp was 100 μL. Or utilize recombinant protein to soak prawns (20mg / L), count the mortality rate of prawns (as figure 2 shown), and then use the following method to detect virus replication in shrimp.
[0109] At 24h, 48h and 72h, the genome of the gill tissue of the prawns was extracted using Toyobo’s Genomic DNA Purification Kit (TOYOBO, Genomic DNA Purification Kit). Using the genome as a template, quantification was first performed with actin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 