Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fenneropenaeus chinensis ubiquitin-conjugating enzyme gene and ubiquitin-conjugating enzyme coded by same and application

A technology of ubiquitin ligase and penaeus prawn is applied in the field of genetic engineering, and can solve the problems such as no reports of ubiquitin ligase gene and application.

Inactive Publication Date: 2011-01-12
SHANDONG UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Many studies have shown that in arthropods such as prawns, there are a variety of proteins or peptides that can resist external pathogenic microorganisms, such as astaxin, crustins, etc., but in related reports, there is no pan- Report on the Gene Ligase and Its Application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fenneropenaeus chinensis ubiquitin-conjugating enzyme gene and ubiquitin-conjugating enzyme coded by same and application
  • Fenneropenaeus chinensis ubiquitin-conjugating enzyme gene and ubiquitin-conjugating enzyme coded by same and application
  • Fenneropenaeus chinensis ubiquitin-conjugating enzyme gene and ubiquitin-conjugating enzyme coded by same and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Embodiment 1: the cloning of ubiquitin ligase cDNA of Chinese penaeus prawn

[0068] 1) Extraction of total RNA: Total RNA was extracted by one-step method using the prior art.

[0069] 2) cDNA first-strand synthesis: 4 microliters of total RNA, plus 1 microliter of SmartF (5'-TAC GGC TGC GAG AAGACG ACA GAA GGG-3') and 1 microliter of Oligoanchor R (5'-GAC CAC GCG TAT CGA TGT CGACT16(A / C / G)-3'), react at 72°C for 5 minutes, then add 4 microliters of 5-fold Buffer, 1.25 microliters of dNTP, 0.625 microliters of RNase inhibitor, and 1 microliter of M-MLV reverse transcription Enzyme, 12.875 microliters of RNase-free sterilized water, react at 42°C for 60 minutes, and stop the reaction at 70°C for 10 minutes.

[0070] 3) Rapid amplification of cDNA 3' end of ubiquitin ligase in Penaeus chinensis

[0071] According to the conserved sequence of ubiquitin ligase in other species, the degenerate primer F1 was designed, and the 3' end of ubiquitin ligase was amplified by PCR ...

Embodiment 2

[0092] Example 2: Construction, expression and purification of prokaryotic recombinant expression vectors

[0093] (1) According to the sequence of the ubiquitin ligase of Penaeus prawn and the cloning site of the expression vector pET30a (Novagen Company), design primers:

[0094] FcUbc ExF: 5′TACTCA GAATTC ATGACGGCACTGCAGAGAATA 3′ (EcoR I)

[0095] FcUbc ExR: 5′ TACTCA CTCGAG CGTGAGCATAGAAGGAAGGAA 3′ (Xho I)

[0096] The present invention selects the EcoR I and Xho I restriction sites of the pET30a cloning site. Therefore, when designing the primers, the EcoR I restriction site is introduced into the upstream primer, and the Xho I restriction site is introduced into the downstream primer.

[0097] (2) Gene amplification, cloning and recombinant plasmid screening

[0098] Hepatopancreas cDNA was used as a template, and the above primers were used for PCR reaction. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 30s, 55°C, 45s, 72°C, 45s, 35 cycle...

Embodiment 3

[0106] Example 3: The Ubiquitin Ligase Recombinant Protein of Chinese Penaeus prawn has antiviral function

[0107] (1) Qualitative analysis of the antiviral effect of FcUbc by semi-quantitative PCR

[0108] Japanese prawns (Marsupenaeus japonicus) were divided into four groups, and Tris-HCl, WSSV, HaGK+WSSV and FcUbc+WSSV were injected into the membrane between the abdominal segment and telson respectively. The concentration of FcUbc is 20 μg / mL, and the concentration of WSSV is 3.2*10 5 / ml, the total injection volume of each shrimp was 100 μL. Or utilize recombinant protein to soak prawns (20mg / L), count the mortality rate of prawns (as figure 2 shown), and then use the following method to detect virus replication in shrimp.

[0109] At 24h, 48h and 72h, the genome of the gill tissue of the prawns was extracted using Toyobo’s Genomic DNA Purification Kit (TOYOBO, Genomic DNA Purification Kit). Using the genome as a template, quantification was first performed with actin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fenneropenaeus chinensis ubiquitin-conjugating enzyme gene with a nucleotide sequence expressed as SEQ ID No. 1, and provides a recombinant expression and purification method thereof. The invention also provides ubiquitin-conjugating enzyme coded by the fenneropenaeus chinensis ubiquitin-conjugating enzyme gene, wherein the amino acid sequence of the ubiquitin-conjugating enzyme is expressed as SEQ ID No. 2; and the invention provides application of the gene sequence and application of the ubiquitin-conjugating enzyme, namely the fenneropenaeus chinensis ubiquitin-conjugating enzyme gene can be used for preparing a prokaryotic expression vector, transforming escherichia coli and expressing recombinant protein with antiviral activity. The recombinant ubiquitin-conjugating enzyme protein obtained by using the invention can be used for antiviral feed additive, animal and plant gene transformation and medicament development.

Description

technical field [0001] The invention relates to a prawn ubiquitin ligase gene and its encoded ubiquitin ligase protein and its application, in particular to a Chinese prawn ubiquitin ligase gene and its encoded ubiquitin ligase and its preparation with antiviral activity The application of the recombinant protein belongs to the technical field of genetic engineering. Background technique [0002] It is well known that although invertebrates do not have adaptive immunity, they have strong innate immune defense responses, mainly including cellular and humoral immunity, relying on these defense responses to remove or eliminate pathogens. In addition, many recent studies have found that the ubiquitin-proteasome system plays an important regulatory role in the process of immune signal transduction. This system is the most important and highly selective protein degradation system known so far. The ubiquitin system can degrade certain immune cell membrane receptors marked by tyros...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N9/00C12N15/70
Inventor 王金星赵小凡
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com