Fenneropenaeus chinensis ubiquitin-conjugating enzyme gene and ubiquitin-conjugating enzyme coded by same and application
A technology of ubiquitin ligase and gene coding, which is applied in the direction of enzymes, enzymes, and the use of vectors to introduce foreign genetic materials, etc., and can solve the problems that there are no reports of ubiquitin ligase genes and applications.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Embodiment 1: the cloning of ubiquitin ligase cDNA of Chinese penaeus prawn
[0068] 1) Extraction of total RNA: Total RNA was extracted by one-step method using the prior art.
[0069] 2) cDNA first-strand synthesis: 4 microliters of total RNA, plus 1 microliter of SmartF (5'-TAC GGC TGC GAG AAGACG ACA GAA GGG-3') and 1 microliter of Oligoanchor R (5'-GAC CAC GCG TAT CGA TGT CGACT16(A / C / G)-3'), react at 72°C for 5 minutes, then add 4 microliters of 5-fold Buffer, 1.25 microliters of dNTP, 0.625 microliters of RNase inhibitor, and 1 microliter of M-MLV reverse transcription Enzyme, 12.875 microliters of RNase-free sterilized water, react at 42°C for 60 minutes, and stop the reaction at 70°C for 10 minutes.
[0070] 3) Rapid amplification of cDNA 3' end of ubiquitin ligase in Penaeus chinensis
[0071] According to the conserved sequence of ubiquitin ligase in other species, the degenerate primer F1 was designed, and the 3' end of ubiquitin ligase was amplified by PCR ...
Embodiment 2
[0092] Example 2: Construction, expression and purification of prokaryotic recombinant expression vectors
[0093] (1) According to the sequence of the ubiquitin ligase of Penaeus prawn and the cloning site of the expression vector pET30a (Novagen Company), design primers:
[0094] FcUbc ExF: 5′TACTCA GAATTC ATGACGGCACTGCAGAGAATA 3′ (EcoR I)
[0095] FcUbc ExR: 5′TACTCA CTCGAG CGTGAGCATAGAAGGAAGGAA 3′ (Xho I)
[0096] The present invention selects the EcoR I and Xho I restriction sites of the pET30a cloning site. Therefore, when designing the primers, the EcoR I restriction site is introduced into the upstream primer, and the Xho I restriction site is introduced into the downstream primer.
[0097] (2) Gene amplification, cloning and recombinant plasmid screening
[0098] Hepatopancreas cDNA was used as a template, and the above primers were used for PCR reaction. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 30s, 55°C, 45s, 72°C, 45s, 35 cycles...
Embodiment 3
[0106] Example 3: The Ubiquitin Ligase Recombinant Protein of Chinese Penaeus prawn has antiviral function
[0107] (1) Qualitative analysis of the antiviral effect of FcUbc by semi-quantitative PCR
[0108] Japanese prawns (Marsupenaeus japonicus) were divided into four groups, and Tris-HCl, WSSV, HaGK+WSSV and FcUbc+WSSV were injected into the membrane between the abdominal segment and telson respectively. The concentration of FcUbc is 20 μg / mL, and the concentration of WSSV is 3.2*10 5 / ml, the total injection volume of each shrimp was 100 μL. Or utilize recombinant protein to soak prawns (20mg / L), count the mortality rate of prawns (as figure 2 shown), and then use the following method to detect virus replication in shrimp.
[0109] At 24h, 48h and 72h, the genome of the gill tissue of the prawns was extracted using Toyobo’s Genomic DNA Purification Kit (TOYOBO, Genomic DNA Purification Kit). Using the genome as a template, quantification was first performed with actin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
