Novel xylanase V-XYL as well as gene, high-efficiency expression method and application thereof
A technology of xylanase and gene, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Embodiment 1, the separation and cultivation of xylanase-producing Escherichia coli Escherichia coli
[0070] The rumen content of cattle from a cattle farm in Inner Mongolia was enriched and cultured (enrichment medium: (NH4) 2 SO 4 5g / L, KH 2 PO 4 1g / L, MgSO 4 ·7H 2 O 0.5g / L, FeSO 4 ·7H 2 O 0.01g / L, CaCl 2 0.2g / L, 0.5% corn cob powder, 0.5% bran, pH4), and spread it on the enzyme-producing medium ((NH 4 ) 2 SO 4 5g / L, KH 2 PO 4 1g / L, MgSO 4 ·7H 2 O 0.5g / L, FeSO 4 ·7H 2 O 0.01g / L, CaCl 2 0.2g / L, 1% xylan, 1.5% agarose, pH 4) on a plate, culture at 30°C for 5-6 days, pick and separate colonies with transparent circles on the enzyme-producing medium plate, and repeat the streaking for 3 rounds Isolate and purify the strain. A strain expressing xylanase was screened by this method, and was identified as Escherichia coli, and the preservation number of the strain was: CGMCC No.4234.
Embodiment 2
[0071] Embodiment 2, the cloning of Escherichia coli xylanase gene V-XYL of Escherichia coli
[0072] The cloning of xylanase gene V-XYL adopts the method of constructing a genome library. First, the genome of Escherichia coli is extracted, and the genome library of E. coli is constructed according to the instructions of the gene library construction kit Lamda Zap II.
[0073] The specific method is to cultivate and screen the xylanase-producing Escherichia coli strain and extract its genome DNA. The obtained Escherichia coli genomic DNA and the phage vector Lambda Zap II were digested with the restriction endonuclease EcoRI and ligated overnight. After in vitro packaging, transfect Escherichia coli recipient strain XL1-Blue MRF', spread the plate, and cultivate overnight at 37.
[0074] The titer of the gene library obtained by identifying the construction ensures that dense relatively independent phage plaques are obtained on each plate. The enzyme-producing medium plate c...
Embodiment 3
[0077] Example 3, Construction of Pichia pastoris engineering bacteria comprising xylanase gene V-XYL
[0078]According to the gene sequence, primers VXYL-eco and VXYL-not with EcoR I and Not I restriction sites were designed, and the xylanase gene V-XYL was inserted into the EcoR I and Not I restriction enzyme sites on the plasmid pPICzalphaA Between the dots, the nucleotide sequence is located downstream of the AOX1 promoter and is regulated by it to obtain the recombinant yeast expression plasmid pPICzαA-V-XYL.
[0079] VXYL-eco: 5'AGCTGAATTCATGGTAAGTCGACATCT3'
[0080] VXYL-not: 5'TGGTGCGGCCGCCTAAGAAGTTTTTAATCCTTCT3'
[0081] The recombinant yeast expression plasmid pPICzαA-V-XYL was linearized with SacI, and the linearized recombinant vector was electroporated to transform Pichia pastoris X33 to obtain Pichia pastoris recombinant strain X33 / V-XYL.
[0082] The above-mentioned recombinant strains were inoculated in BMGY culture medium, shaken at 250 rpm at 30° C. for 48 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More