Construction method of efficiently-expressed plasmid for producing lipase gene

The technology of a lipase gene and a construction method is applied in the construction of plasmids and the construction of plasmids producing lipase genes, which can solve the problems of inconspicuousness, unclear goals and limitations, and achieve the effect of efficient and stable expression.

Active Publication Date: 2011-08-17
ANHUI LEVEKING BIOTECH CO LTD
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional strain breeding method mainly relies on random physical and chemical mutagenesis, which has unclear goals, is time-consuming and laborious, a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of efficiently-expressed plasmid for producing lipase gene
  • Construction method of efficiently-expressed plasmid for producing lipase gene
  • Construction method of efficiently-expressed plasmid for producing lipase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the construction of overexpression vector

[0042] Take the following steps:

[0043] (1) Utilize restriction endonuclease Sac I, Kpn I hygromycin resistance expression cassette is digested from plasmid PV2+ (such as figure 1 shown), the fragment was recovered by gel, and cloned into the pCAMBIA2300 plasmid (such as figure 2 Shown), the recombinant plasmid pCHAMBIA2302 with hygromycin resistance was obtained (such as image 3 shown); the hygromycin expression cassette can also be derived from any other DNA containing this sequence or directly synthesized, and the plasmid used to construct the PEL gene overexpression vector can also be expressed in filamentous fungi such as pCAMBIA1300 except for pCAMBIA2300 , pCAMBIA3300 and other pCAMBIA series vectors and pHB vectors;

[0044] (2) According to the sequence design primer (forward primer: TG) of the lipase gene PEL (AF330635) of Penicillium expanded ACTAGTATGTTGTTCAACTACCAATCTTT The underlined sequen...

Embodiment 2

[0050] Embodiment two, the acquisition of Penicillium genetically engineered bacteria

[0051] The activity of described Penicillium genetically engineered bacterium comprises the steps:

[0052] (1) Pick the isolated and purified wild-type Penicillium and inoculate it on a PDA plate, cultivate it at 28°C for about 20 days, and wash the mature spores with sterile water;

[0053] (2) Inoculate the engineered Agrobacterium EHA105 containing the final vector pCHAMBIA2302::PgpdA-PEL-TtrpC in Example 1 in the LB liquid medium containing streptomycin and kanamycin (both 100 μg / ml) at 28°C, Cultivate overnight at 200 rpm, reactivate with MM medium containing streptomycin and kanamycin (both 100 μg / ml), and culture at 220 rpm for 48 hours at 28°C. Take an appropriate amount of culture and centrifuge at 5000rpm to remove the supernatant, wash with 1M liquid medium, and finally dilute to OD600=0.15 with 1M liquid medium, then cultivate at 28°C and 220rpm for 6-8 hours until OD600=0.5- ...

Embodiment 3

[0061] Embodiment 3, comparative experiment of producing lipase ability

[0062] Randomly select the Penicillium genetically engineered bacterium that example 2 gained is inoculated on the PDA medium, insert in the seed culture medium 50mL respectively after cultivating 10 days, at 28 ℃, 210rpm shaker culture 24h, then transfer to respectively with 10% inoculum amount Fermentation medium (30mL fermentation medium in 250mL Erlenmeyer flask) was fermented at 28°C and 210rpm for 48h; then the fermentation broth was centrifuged, and the supernatant was taken for lipase activity detection.

[0063] The lipase activity was detected by acid-base titration.

[0064] step:

[0065] Take 20 100mL Erlenmeyer flasks, add 4.0mL Gly-NaOH buffer solution with pH 9.4 and 5.0mL olive oil emulsion respectively; put them into a oscillating constant temperature water bath at 36°C to preheat for 5 minutes. After filtering the enzyme solution, use 0.05 mol / L Gly-NaOH buffer solution of pH 9.4 was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The application of the invention provides a construction method of an efficiently-expressed plasmid for producing lipase gene. The method comprises the following steps: cloning an obtained hygromycin-resistant expression box on an objective plasmid so as to obtain a hygromycin-resistant recombinant plasmid; the respectively amplifying lipase gene (PEL) of blue mould, aspergillus nidulans strong promoter 3-phosphoglyceraldehydedehydrogenase promoter (PgpdA) and aspergillus nidulans tryptophan synzyme terminator (TtrpC) by PCR (polymerase chain reaction) technology to obtain a PEL gene expression box driven by a strong promoter; and inserting the PEL gene expression box into the hygromycin-resistant recombinant plasmid to obtain a hygromycin selection marker-containing PEL gene overexpression vector. The efficiently-expressed plasmid for producing lipase gene is transferred to obtain the genetic engineering penicillium of the efficiently-expressed plasmid, high-efficiency and stable in expression. Compared with conventional lipase production method, the construction method has great advantages.

Description

Technical field: [0001] The application of the present invention relates to a method for constructing a plasmid, specifically, a method for constructing a lipase-producing gene plasmid capable of high-efficiency expression, and belongs to the technical field of genetic engineering. Background technique [0002] In recent years, lipase (Lipase EC) has made great progress in industrial application. Alkaline lipase is a lipase that hydrolyzes under alkaline conditions. It can hydrolyze natural oils and produce fatty acids and glycerol. An enzyme that hydrolyzes special esters at the oil-water interface of a phase system. Alkaline lipase has the advantages of high substrate hydrolysis efficiency, mild reaction, non-toxicity, and ability to hydrolyze fat under certain conditions. It has been widely used in detergents, papermaking, tanning, food, textile and light industry , and has become an important variety in the enzyme preparation market all over the world. [0003] In the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/66
Inventor 王剑英张田唐可轩王节亮
Owner ANHUI LEVEKING BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap