Check patentability & draft patents in minutes with Patsnap Eureka AI!

Construction method for constitutive expression engineering bacteria of dextranase and preparation method for enzyme

A technology of dextranase and expression vector, which is applied in the field of genetic engineering and protein secretion and expression, can solve the problems of high cost, unfavorable safety production and safe use, etc., and achieve the effect of reducing cost, eliminating hidden dangers of production safety, and safe and simple process conditions

Inactive Publication Date: 2013-03-20
GUANGDONG PROVINCIAL BIOENGINEERING INST (GUANGZHOU SUGARCANE IND RES INST)
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005]At present, dextranase is mainly obtained from strains such as Penicillium lilacinum and Chaetomium sp. reported, but the prepared dextranase can not well adapt to the temperature and pH in the sugar production process, and the preparation process needs to use inducers, some of which are dextran with higher cost, and some use flammable, explosive and toxic methanol, which is not conducive to Safe production and safe use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for constitutive expression engineering bacteria of dextranase and preparation method for enzyme
  • Construction method for constitutive expression engineering bacteria of dextranase and preparation method for enzyme
  • Construction method for constitutive expression engineering bacteria of dextranase and preparation method for enzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] A method for constructing a constitutively expressed engineering strain of dextranase, comprising the steps of:

[0032] (1) Genomic DNA of Penicillium minioluteum was used as template, Primer1: GCGCGAATTCATGACATTAATCT (SEQ ID NO: 1) and Primer2: ATCGCGGCCGCGTTTATGGACCATTG (SEQ ID NO: 2) were used as primers, and the restriction enzyme EcoRI was included in the primers respectively and NotI site, PCR, amplified to obtain the dextranase gene, electrophoresis identification;

[0033] (2) The amplified product and plasmid pGAPZαA were digested with EcoRI and NotI, ligated, and the recombinant plasmid pGAPZαA-dex was constructed and identified by double digestion;

[0034] (3) The expression vector pGAPZαA-dex was single-digested with AvrII to make it linearized, and the competent Pichia pastoris KM71H was transformed by electroporation, and the positive clone KM71H-dex was screened on the YPD plate containing Zeocin.

[0035] The detection results of PCR amplification pro...

Embodiment 2

[0040] A method for preparing dextranase (shake flask fermentation culture), the steps are as follows:

[0041] (1) Medium composition: 1% yeast extract + 2% peptone + 3% (w / v) glycerol;

[0042] (2) Inoculation: inoculate the engineering strain of Pichia pastoris (KM71H-dex) selected in Example 1 into the above-mentioned medium for cultivation, and the cultivation conditions are: 25ml liquid volume in a 250ml Erlenmeyer flask, temperature 30°C, rotation speed 200r / min;

[0043] (3) After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 60U;

[0044] (4) Separation and purification of dextranase: Use centrifugation and filtration to separate cells, then concentrate the fermentation broth, select an appropriate ultrafiltration membrane to cut off, carry out low-temperature spray drying or carrier adsorption, and obtain dextranase.

Embodiment 3

[0046] A method for preparing dextranase (shake flask fermentation culture), the steps are as follows:

[0047] (1) Medium composition: yeast powder 10g / L, peptone 20g / L, yeast nitrogen source (without amino acid) 13.4g / L, D-biotin 0.4μg / mL, glycerol 10g / L;

[0048] (2) Inoculation: inoculate the engineering strain of Pichia pastoris (KM71H-dex) selected in Example 1 into the above-mentioned medium for cultivation, and the cultivation conditions are: 25ml liquid volume in a 250ml Erlenmeyer flask, temperature 30°C, rotation speed 200r / min;

[0049] (3) After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 120U;

[0050] (4) Separation and purification of dextranase: separate the cells by centrifugation and filtration, then concentrate the fermentation broth, select an appropriate ultrafiltration membrane to cut off, carry out low-temperature spray drying or carrier adsorption, and obtain dextranase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method for constitutive expression engineering bacteria of dextranase and a preparation method for enzyme. The construction method for the constitutive expression engineering bacteria comprises the following steps of: (1) inserting an obtained gene in a multi cloning site of an expression vector pGAPZalphaA to construct a recombinant plasmid pGAPZalphaA-dex;and (2) linearly transforming the recombinant plasmid to Pichia pastoris KM71H, and screening positive clone bacteria. The engineering bacteria are used in a preparation method for the dextranase. Bythe invention, the gene of the dextranase is effectively expressed in the Pichia pastoris successfully, a cheap carbon source is taken as a raw material, flammable and explosive methanol is not needed in the fermentation process, potential production safety hazards are eliminated, a fermentation process for the dextranase is enlarged, and the cost is reduced to the greatest extent.

Description

technical field [0001] The invention relates to the fields of genetic engineering and protein secretion and expression, in particular to the construction of engineering strains constitutively secreting and expressing protease and the preparation method of protease. Background technique [0002] If sugarcane is wounded or crushed, pests, fire, frost or left for a long time after harvest, it will be infected by microorganisms such as Leuconostoc mesnteroides and Streptococcus to form α-glucose Sugar (dextran). The concentration of α-glucan in cane juice can be as high as 1%, and in severe cases, a white solid substance (commonly known as "cane rice") will be formed. The appearance of α-glucan will not only cause the direct loss of sugar, but also increase the difficulty of the sugar making process, and the resulting sugar loss is 3-5 times that of the direct loss of sugar. Therefore, how to reduce α-glucan and reduce its negative impact is an urgent problem to be solved in m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81C12N9/46C12R1/84
Inventor 梁达奉曾练强黄曾慰蚁细苗吴兆鹏李锦荣李雨虹张远平黄玉南
Owner GUANGDONG PROVINCIAL BIOENGINEERING INST (GUANGZHOU SUGARCANE IND RES INST)
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More