Construction method of engineering bacteria with constitutive expression of dextranase and preparation method of enzyme
A dextranase and constitutive expression technology, applied in the fields of genetic engineering and protein secretion expression, can solve the problems of high cost, unfavorable safety production and safe use, and achieve cost reduction, elimination of production safety hazards, and safe and simple process conditions Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] A method for constructing a constitutively expressed engineering strain of dextranase, comprising the steps of:
[0032] (1) Genomic DNA of Penicillium minioluteum was used as a template, Primer1: GCGCGAATTCATGACATTAATCT (SEQ ID NO: 1) and Primer2: ATCGCGGCCGCGTTTATGGACCATTG (SEQ ID NO: 2) were used as primers, and the restriction enzyme EcoRI was included in the primers respectively and NotI site, PCR, amplified to obtain the dextranase gene, electrophoresis identification;
[0033] (2) The amplified product and plasmid pGAPZαA were digested with EcoRI and NotI, ligated, and the recombinant plasmid pGAPZαA-dex was constructed and identified by double digestion;
[0034] (3) The expression vector pGAPZαA-dex was digested with AvrII to linearize it, and the competent Pichia pastoris KM71H was transformed by electroporation, and the positive clone KM71H-dex was screened on the YPD plate containing Zeocin.
[0035] The detection results of PCR amplification products were ...
Embodiment 2
[0040] A method for preparing dextranase (shake flask fermentation culture), the steps are as follows:
[0041] (1) Medium composition: 1% yeast extract + 2% peptone + 3% (w / v) glycerol;
[0042] (2) Inoculation: inoculate the engineering strain of Pichia pastoris (KM71H-dex) selected in Example 1 into the above-mentioned medium for cultivation, and the cultivation conditions are: 25ml liquid volume in a 250ml Erlenmeyer flask, temperature 30°C, rotation speed 200r / min;
[0043] (3) After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 60U;
[0044] (4) Separation and purification of dextranase: separate the cells by centrifugation and filtration, then concentrate the fermentation broth, select an appropriate ultrafiltration membrane to cut off, carry out low-temperature spray drying or carrier adsorption, and obtain dextranase.
Embodiment 3
[0046] A method for preparing dextranase (shake flask fermentation culture), the steps are as follows:
[0047] (1) Medium composition: yeast powder 10g / L, peptone 20g / L, yeast nitrogen source (without amino acid) 13.4g / L, D-biotin 0.4μg / mL, glycerol 10g / L;
[0048] (2) Inoculation: inoculate the engineering strain of Pichia pastoris (KM71H-dex) selected in Example 1 into the above-mentioned medium for cultivation, and the cultivation conditions are: 25ml liquid volume in a 250ml Erlenmeyer flask, temperature 30°C, rotation speed 200r / min;
[0049] (3) After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 120U;
[0050] (4) Separation and purification of dextranase: separate the cells by centrifugation and filtration, then concentrate the fermentation broth, select an appropriate ultrafiltration membrane to cut off, carry out low-temperature spray drying or carrier adsorption, and obtain dextranase.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap