Silkworm fibroin heavy-chain gene mutation sequence and mutation method and application

A heavy chain gene and silk technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., to achieve the effect of increasing expression and purity

Active Publication Date: 2012-02-22
SOUTHWEST UNIV
View PDF3 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although scholars have also made some explorations in silkworm gene targeting, there is currently no available targeted modification technology for the silkworm genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Silkworm fibroin heavy-chain gene mutation sequence and mutation method and application
  • Silkworm fibroin heavy-chain gene mutation sequence and mutation method and application
  • Silkworm fibroin heavy-chain gene mutation sequence and mutation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1: Sequence analysis of silk fibroin heavy chain gene of silkworm

[0055] Download the silk fibroin heavy chain gene sequence (No. AF226688) from the NCBI database, and its sequence structure is as follows: figure 1 shown. Bombyx mori silk fibroin heavy chain gene (+1~+16 788, where +1 indicates the transcription start site) includes two exons with a length of 67bp and 15750bp and an intron with a length of 971bp, the first exon The exon includes a 25bp untranslated region (+1~+25) and a 42bp coding region (+26~+67). region (+16396~+16788) and highly repetitive region (+1450~+16395, figure 1 shown in the gray box). The N-terminal of the amino acid sequence encoded by silkworm silk fibroin heavy chain gene contains a signal peptide with a length of 21 amino acid residues ( figure 1 underlined).

[0056] In order to select zinc finger nuclease target sites that can play a role in various silkworm strains, we performed SNP analysis on the N-terminal part...

Embodiment 2

[0057] Example 2: Design and synthesis of silk fibroin heavy chain gene-specific zinc finger nuclease sequence

[0058] According to the sequence characteristics of silk fibroin heavy chain gene and its SNP distribution in different silkworm strains, combined with the characteristics of zinc finger protein recognition of DNA sequences, we selected CTGTTGCTCAAAGTTATGTTGCTGCTGATGCGGGAGCA as the target site for zinc finger nuclease recognition. +1325-+1362 positions of the sequence shown in SEQ ID NO:1, and design and synthesize zinc finger nuclease accordingly.

[0059] Therefore, positions 1325-1362 of silk fibroin heavy chain gene are the target sites recognized by zinc finger nuclease.

[0060]

Embodiment 3

[0061] Example 3: Preparation of zinc finger nuclease mRNA

[0062] Artificially synthesized or amplified from the existing zinc finger protein library to obtain the nucleic acid sequence of zinc finger nuclease (such as SEQ ID NO: 119 and SEQ ID NO: 120) with restriction endonucleases EcoRI and XhoI (purchased from TAKARA) After double enzyme digestion, carry out a ligation reaction with the prokaryotic expression vector pET28a that has undergone the same enzyme digestion, transform Escherichia coli and screen positive clones to obtain a recombinant vector. The specific reaction system for enzyme digestion is as follows:

[0063]

[0064] The recombinant vector was digested with XhoI and then transcribed in vitro with the MessageMax T7 mRNA in vitro transcription kit (purchased from Epicentre). The reaction system was as follows:

[0065]

[0066] Incubate the above reaction system at 37°C for 30 minutes, then add 1 μl DNase, and continue to incubate for 15 minutes. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a silkworm fibroin heavy-chain gene mutation method, which specifically comprises the step of: acting mRNA (Messenger Ribonucleic Acid) of a coded zinc-finger nuclease sequence on loci 1325-1362 of a silkworm fibroin heavy-chain gene shown as SEQ ID NO:1 to form target positions for recognizing zinc-finger nuclease, thereby obtaining a series of silkworm fibroin heavy-chain mutated genes; and the mutated sequence can be applied to preparation of sericin and extrinsic proteins. Mutants provided by the invention have the following advantages that: (1) a posterior division of silkgland of a fibroin heavy-chain gene mutant provided by the invention serious degrades, a cocoon shell only contains the sericin synthesized and secreted by a middle division of silkgland, if the mutated strains are utilized to transgenically express the extrinsic proteins, the expressed amount and the purity of the extrinsic proteins can be greatly increased, and thus, a brand-new useful genetic material is provided for the development of a silkworm fibroin bioreactor; and (2) the cocoon shell of the mutated strain provided by the invention only contains the sericin, and thus, a new source is provided for the large-scale production of the sericin.

Description

technical field [0001] The invention belongs to the fields of silkworm breeding and genetic engineering, and relates to silk fibroin heavy chain gene mutants based on different existing silkworm varieties, a preparation method, a mutation sequence and uses thereof. Background technique [0002] The silkworm is famous all over the world for its powerful ability to produce silk and spin silk. It has made important contributions to the world economy and cultural exchanges during the thousands of years of breeding and domestication. It is still the industry leader in China, India and other countries. An important part of. However, for a long time, people have been breeding silkworm varieties with the improvement of cocoon layer quantity, cocoon layer rate, unwinding and disease resistance as the breeding goals, while ignoring the important factors such as cocoon silk strength, elongation, dyeing performance, skin affinity, etc. index. This is also the main reason why silk is d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/10C12N15/63
CPCC07K2319/60C07K14/43586Y02A50/30
Inventor夏庆友马三垣徐汉福程道军林英赵萍向仲怀
OwnerSOUTHWEST UNIV