Method for preparing beta-mannase and special strain

A technology of mannanase and bacterial strain, which is applied in the field of preparation of β-mannanase, can solve the problems of low yield and achieve the effects of high yield, wide application prospect and low cost

Inactive Publication Date: 2012-05-02
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, the preparation of alkaline β-mannanase is still a bottleneck that limits its industrial application. In previous reports, no matter whether the original strain of alkaline β-mannanase was used or the recombinant strain was used for production, Its output is relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing beta-mannase and special strain
  • Method for preparing beta-mannase and special strain
  • Method for preparing beta-mannase and special strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1, construction of alkaline mannanase secretion expression vector

[0051] 1. Cloning of alkaline mannanase gene

[0052] Design and synthesize primers

[0053] Primer 1 (Forward): 5'ATAT CTCGAG AAAAGATCCCCATCAGAAGC 3’

[0054] Primer 2 (Reverse): 5'CGGGC GAATTC TATCTTAAAGTAACATTAT 3’

[0055] There is an XhoI restriction site (CTCGAG, corresponding to the amino acid sequence Leu-Glu) downstream of the α-mating factor signal peptide coding sequence, followed by a Kex2 protease recognition site (AAAAGA, corresponding to the amino acid sequence Lys-Arg), so , Primer 1 was designed to introduce the XhoI site and Kex2 protease recognition site sequence before the mannanase gene. Through this design, the mannanase gene can be directly connected after the signal peptide sequence, so that after the protein is translated, under the action of Pichia pastoris' own Kex2 protease, it can cut and express the target protein with unchanged amino acid (instead of Add...

Embodiment 2

[0092] Embodiment 2, preparation of mannanase by fermenting recombinant bacteria

[0093] In the following experiments, all recombinant bacteria used were Pichia pastoris GS4SMANCGMCC NO.4095.

[0094] Yeast extract was purchased from OXOID company, the product catalog number is LP0021. Peptone was purchased from BD Company, the product catalog number is 211677. YNB was purchased from BD Company, the product catalog number is 291940. Biotin was purchased from Beijing Chemical Reagent Company, catalog number 67000294.

[0095] Fermentation medium (BMGY liquid medium): Mix 10 grams of yeast extract and 20 grams of peptone, sterilize at 121°C for 20 minutes, add 13.4 grams of YNB, 4×10 -4 gram of biotin and 10 grams of glycerol, and make up to 1 liter with water.

[0096] PTMs 1 (1L): CuSO 4 ·5H 2 O 6g, KI 0.08g, MnSO 4 2.68g, H 3 BO 3 0.02g, Na 2 MoO 4 2H 2 O 0.2g, ZnSO 4 ·7H 2 O 20g, FeSO 4 ·7H 2 O 65g, CoCl 2 ·6H 2 O 0.916, H 2 SO 4 Mix 5 mL with 0.2 g o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for preparing beta-mannase and a special strain. The strain is Pichia pastoris GS4SMAN CGMCC NO.4095. The recombinant strain disclosed by the invention contains a plurality of copied mannase genes expressed under methanol induction. Experiments show that by means of a process, disclosed by the invention, for producing alkaline mannase through high-density fermentation by using the recombinant strain, the enzyme activity of the alkaline mannase can reach 6336u / ml finally in an induction period of 84 hours. The method disclosed by the invention has the advantages of low cost, simplicity for operation and high yield. Therefore, the method disclosed by the invention has a wide application prospect in the field of mannase preparation.

Description

technical field [0001] The invention relates to a method for preparing β-mannanase and a special bacterial strain. Background technique [0002] β-mannanase (β-1,4-D-mannan mannohydrolase; EC31211178) is a class of backbone β- The enzyme of 1,4-D-mannopyranose, which is used in the utilization of various β-glucosides present in some plants such as the endosperm of copra, the nuts of the ivory palm tree, the tubers of guar, acacia, coffee tree and konjac -Mannan is of potential importance. At home and abroad, it is mainly used for pulp bleaching in papermaking industry, gel breaking in oil wells, degrading plant gums to produce oligosaccharides as growth-promoting factors for bifidobacteria, health food for disease prevention and anti-aging, and anti-nutritional factors in the feed industry. [0003] β-mannanase is divided into acidic, neutral and alkaline according to its optimal pH value, among which alkaline β-mannanase refers to the β-mannan with the highest catalytic a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/56C12N9/42C12N15/63C12R1/84
Inventor 马延和朱泰承游丽金李寅薛燕芬
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap