Method for preparing beta-mannase and special strain
A technology of mannanase and bacterial strain, which is applied in the field of preparation of β-mannanase, can solve the problems of low yield and achieve the effects of high yield, wide application prospect and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1, construction of alkaline mannanase secretion expression vector
[0051] 1. Cloning of alkaline mannanase gene
[0052] Design and synthesize primers
[0053] Primer 1 (Forward): 5'ATAT CTCGAG AAAAGATCCCCATCAGAAGC 3’
[0054] Primer 2 (Reverse): 5'CGGGC GAATTC TATCTTAAAGTAACATTAT 3’
[0055] There is an XhoI restriction site (CTCGAG, corresponding to the amino acid sequence Leu-Glu) downstream of the α-mating factor signal peptide coding sequence, followed by a Kex2 protease recognition site (AAAAGA, corresponding to the amino acid sequence Lys-Arg), so , Primer 1 was designed to introduce the XhoI site and Kex2 protease recognition site sequence before the mannanase gene. Through this design, the mannanase gene can be directly connected after the signal peptide sequence, so that after the protein is translated, under the action of Pichia pastoris' own Kex2 protease, it can cut and express the target protein with unchanged amino acid (instead of Add...
Embodiment 2
[0092] Embodiment 2, preparation of mannanase by fermenting recombinant bacteria
[0093] In the following experiments, all recombinant bacteria used were Pichia pastoris GS4SMANCGMCC NO.4095.
[0094] Yeast extract was purchased from OXOID company, the product catalog number is LP0021. Peptone was purchased from BD Company, the product catalog number is 211677. YNB was purchased from BD Company, the product catalog number is 291940. Biotin was purchased from Beijing Chemical Reagent Company, catalog number 67000294.
[0095] Fermentation medium (BMGY liquid medium): Mix 10 grams of yeast extract and 20 grams of peptone, sterilize at 121°C for 20 minutes, add 13.4 grams of YNB, 4×10 -4 gram of biotin and 10 grams of glycerol, and make up to 1 liter with water.
[0096] PTMs 1 (1L): CuSO 4 ·5H 2 O 6g, KI 0.08g, MnSO 4 2.68g, H 3 BO 3 0.02g, Na 2 MoO 4 2H 2 O 0.2g, ZnSO 4 ·7H 2 O 20g, FeSO 4 ·7H 2 O 65g, CoCl 2 ·6H 2 O 0.916, H 2 SO 4 Mix 5 mL with 0.2 g o...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com