Reductase, gene and recombinase of reductase and preparation method and application of recombinase

A reductase and gene technology, applied in the field of bioengineering, can solve the problems of low overall catalytic activity, narrow asymmetric reduction substrate spectrum, low enzyme yield, etc., to achieve strong stereoselectivity, wide substrate applicability, catalytic Efficient effect

Inactive Publication Date: 2012-07-11
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved by the present invention is aimed at using the wild bacillus (Bacillus sp.) CGMCC No.2549 whole cell as aryl ketone asymmetric reduction catalyst when the enzyme yield is low so that the overall catalytic activity is not high, the asymmetric reduction substrate spectrum narrow defect, and provide a reductase with excellent asymmetric catalytic activity, wide substrate applicability, environment-friendly and its gene, as well as a recombinant expression vector containing the gene and a recombinant expression transformant, as well as its recombination Enzyme and the preparation method of the recombinase, and the application of the reductase or its recombinase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reductase, gene and recombinase of reductase and preparation method and application of recombinase
  • Reductase, gene and recombinase of reductase and preparation method and application of recombinase
  • Reductase, gene and recombinase of reductase and preparation method and application of recombinase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Cloning of embodiment 1 reductase gene

[0051] According to the gene sequence of the reductase YtbE, FabG and YueD of Bacillus subtilis (Bacillus subtilis) 168 that has been recorded in Genbank, the PCR primers were designed as follows:

[0052] Primer 1 (amplification of BCR I gene):

[0053] Upstream primer: CGC GGATCC ATGACAACACATTTACAAAGCAAAAG

[0054] Downstream primer: CCG GTCGAG TTAAAAATCAAAGTTGTCCGGATC

[0055] Primer 2 (amplification of BCR II gene):

[0056] Upstream primer: CGC GGATCC ATGCTTAATGATAAAACGGCT

[0057] Downstream primer: CCG GTCGAG TTACATCACCATTCCGCC

[0058] Primer 3 (amplification of BCR III gene):

[0059] Upstream primer: CGC GGATCC ATGGAACTTTATATCATCACCGGAG

[0060] Downstream primer: CCG GTCGAG CTACAAAAACTCTTTAATATCATAAATGCG

[0061] Wherein, the underlined part of the upstream primer is the BmHI restriction site, and the underlined part of the downstream primer is the XhoI restriction site.

[0062] The genomic DNA of Ba...

Embodiment 2

[0066] Embodiment 2 Preparation of recombinant expression vector (plasmid) and recombinant expression transformant

[0067] The reductase gene obtained in Example 1 was connected to the pMD-18T vector to construct cloning plasmids pBCRI-18T, pBCRII-18T and pBCRIII-18T, respectively. Afterwards, they were transformed into Escherichia coli (E.coli) DH5α competent cells, positive clones were screened by colony PCR, plasmids were extracted, and digested with restriction endonucleases BamHI and XhoI at 37°C for 12 hours, gelatinized in agarose Purify by gel electrophoresis, use the agarose gel DNA recovery kit to recover the target fragment, and prove that it contains the correct insert fragment ( figure 2 ). Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET28a digested with BamHI and XhoI at 4°C overnight to obtain recombinant expression plasmids pET-BCRI, pET-BCRII and pET-BCRIII.

[0068] Transform the above-mentioned recombinant expressi...

Embodiment 3

[0069] Embodiment 3 expression of recombinant reductase

[0070] The 3 kinds of recombinant Escherichia coli obtained in Example 2 were inoculated into the LB medium containing ampicillin respectively, and cultured with shaking at 37°C overnight, and were inserted into 50ml LB medium ( Peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, pH 7.0) in a 250ml Erlenmeyer flask, cultured on a shaker at 37°C and 180rpm, when the OD of the culture solution 600 When it reaches 0.6, add IPTG with a final concentration of 0.5mmol / L as an inducer, and after induction at 25°C for 12h, centrifuge the culture medium, collect the cells, wash twice with normal saline, and suspend the resulting resting cells in pH 7.0 buffer solution, sonicate in an ice bath, and centrifuge to collect the supernatant, which is the crude enzyme solution of the recombinant reductase. The crude enzyme solution was analyzed by polyacrylamide gel electrophoresis ( Figure 8 ), most of the three recombinant proteins exi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reductase, a gene of the reductase, a recombinant expression vector and recombinant expression transformant which contain the gene, a recombinase of the reductase, a preparation method of the recombinase, and an application of the reductase or the recombinase thereof used as a catalyst in the asymmetric reduction of a prochiral carbonyl compound so as to prepare chiral alcohols with optical activities. The reductase or the recombinase thereof can derive from Bacillus sp. of which is the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.2549, can be used as the catalyst in the asymmetric reduction of the prochiral carbonyl compound so as to prepare various chiral alcohols with optical activities, and has high catalytic efficiency and strong stereoselectivity; and the applicable reaction conditions are mild and the reductase or recombinase is environmentally friendly. Compared with the intact cells of the wild-type Bacillus sp. of which preservation number is CGMCC No.2549, the reductase has better catalytic effect and higher substrate applicability; and the reductase has very good industrial application and development prospects.

Description

[0001] This application is a divisional application of a patent application titled "A Reductase and Its Gene, Recombinase, Preparation Method and Application", application number 201010527409.0, and filing date October 29, 2010. technical field [0002] The invention belongs to the technical field of bioengineering, and specifically relates to a reductase and its gene, a recombinant expression vector and a recombinant expression transformant containing the gene, a recombinase thereof and a preparation method of the recombinase, and the reductase or its recombination Application of recombinant enzymes as catalysts in the asymmetric reduction of prochiral carbonyl compounds to prepare optically active chiral alcohols. Background technique [0003] Optically active chiral alcohols containing specific functional groups are important chiral building blocks for the synthesis of medicines, pesticides and other fine chemicals. Researchers have developed a variety of methods for the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/63C12N15/70C12N1/21C12P7/22C12P17/12C12P7/62C12R1/07C12R1/19
Inventor许建和倪燕李春秀张杰潘江王丽娟
OwnerEAST CHINA UNIV OF SCI & TECH