Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Receptor protein kinase gene and expression vector and application thereof

A technology of receptor protein and expression vector, applied in the field of genetic engineering, can solve problems such as poisoning, quality decline, pollution, etc.

Active Publication Date: 2012-07-18
NANJING AGRICULTURAL UNIVERSITY
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Wheat head blight (FHB) is a fungal disease, which can cause diseases to crops such as wheat, barley and corn, and directly cause crop yield and quality decline; ) and some other trichothecene toxins, human and animals will be poisonous if swallowed by mistake

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Receptor protein kinase gene and expression vector and application thereof
  • Receptor protein kinase gene and expression vector and application thereof
  • Receptor protein kinase gene and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Cloning of a receptor protein kinase gene in ear tissue induced by Gibberella in Wangshuibai

[0028] Wangshuibai (Analysis of the combining ability of DON content in common wheat grains by Pei Ziyou, Jia Gaofeng, etc., ACTA AGRONOMICA SINICA, 2007, 33(5): 731-737) is a material with high resistance to head blight. In the previous research, our laboratory used fast neutron radiation to screen the mutant NAUH117 (Jin xiao, Xinping Jia et al. A Fast-neutron Induced Fragment Deletion of 3BS in wheat variety Wangshuibai Increased Its Susceptibility to Fusarium Head Blight, Chromosome Research, 2011-2-18, 19: 225-234.), the mutant has chromosomal deletion in some regions of 3BS, and the missing fragment happens to be the main QTL for scab resistance in Wangshuibai your region. In order to obtain genes related to scab resistance in Wangshuibai, the present invention uses wheat gene chips to screen the differentially expressed genes of Wangshuibai and NAUH117 Gibber...

Embodiment 2

[0030] Chromosomal location of embodiment 2 TaRLK-B gene

[0031]Specific primers P1 (tatttcagcagccctatcac, SEQ ID NO.3) and P2 (tgattgatcctggtagcatt, SEQ ID NO.4) were designed according to the TaRLK-B gene sequence, and a set of deletion-tetrasomy and deletion lines (E.R. Sears, Chen Peidu, Weng Yiqun. History of spring aneuploidy in China, Journal of Wheat Crops, 1990, 2: 16-19; Endo Takashi et al. Breeding of common wheat chromosome deletion system, 1995, 2: 5-8. The deficiencies / tetrasomies and deletion line materials used in the invention were quoted from the genomic DNA of the Wheat Genetics Resource Center (Wheat Genetics Resource Centre, Kansas State University, USA) of the U.S. Kansas State University as a template for PCR amplification reaction, and TaRLK-B Genes are physically located on chromosomes. PCR program: 10-50ng DNA template, 0.5μl each of 10μM P1 and P2; 2.5μl 10×buffer; 2.5μl 2.5mM dNTP; 1.5μl 25mM Mg 2+ ; 0.25 μl (5 U / μl) Taq polymerase (TaKaRa), add ...

Embodiment 3

[0032] Embodiment 3 TaRLK-B gene is subjected to the expression characteristic of Gibberella induction

[0033] Using Gibberella spp. to Wangshuibai, NAUH117 and scab-susceptible wheat cultivar Alondra's (Li Minghao, Chen Wei, Xing Liping, et al., Establishment of Genetic Transformation System of Common Wheat Variety Alondra's, Acta Botany, 2010, 45(4): 466- 471.) Induction 0h, 6h, 24h, 48h, 96h, application of primers P1 (tatttcagcagccctatcac, SEQ ID NO.3) and P2 (tgattgatcctggtagcatt, SEQ ID NO.4) that can specifically amplify TaRLK-B, TaRLK-B The B gene was induced by Gibberella and analyzed by real-time fluorescent quantitative PCR (Q-PCR). The total RNA of Wangshuibai, NAUH117 and Alondra's induced at different times were extracted respectively, and the first strand of cDNA was synthesized by reverse transcription: all the reagents used were purchased from Takara Company. Add 1ug total RNA and 2ul Oligo d(T)18primers (100nmol / mL) to a 200ul eppendorf centrifuge tube, mak...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering, and discloses a receptor protein kinase gene and an expression vector and application thereof. The complementary deoxyribonucleic acid (DNA) sequence of the receptor protein kinase gene TaRLK-B is a sequence identifier number 1 (SEQ ID N0.1), and the coded amino acid sequence of the receptor protein kinase gene TaRLK-B is an SEQ ID NO.2. The gene is from a wanghuibai variety of common wheat (Triticum asetivumL.), and is reported in the wheat for the first time. The TaRLK-B is induced by a gibberellic disease in wanghuibai one variety of the wheat capable of resisting the gibberellic disease to be enhanced in expression, and the expression level of the TaRLK-B is much higher than that in Alondra's one variety of the susceptible wheat. The gene is inserted in pAHC25 to obtain an overexpression vector to convert yang wheat 158 one variety of the wheat affected by the gibberellic disease. After identification of T0-generation gibberellic disease resistance, results show that overexpression of the TaRLK-B can improve resistance of varieties of wheat affected by the gibberellic disease on the gibberellic disease.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a receptor protein kinase gene, its expression carrier and application. Background technique [0002] Wheat head blight (FHB) is a fungal disease, which can cause diseases to crops such as wheat, barley and corn, and directly cause crop yield and quality decline; ) and some other trichothecene toxins, human and animals will be poisoned if swallowed by mistake. At present, with the global warming, the disease spreads rapidly in various wheat-growing areas all over the world, and controlling the occurrence and development of wheat head blight has become a worldwide problem. [0003] Breeding wheat varieties resistant to scab is the most economical and effective way to control scab. Clarifying its disease resistance mechanism and cloning disease resistance-related genes have important theoretical guiding significance for the prevention and control of wheat diseases and the improveme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/12C12N15/63A01H5/00
Inventor 肖进王秀娥贾新平王海燕曹爱忠邢莉萍陈佩度赵维萍李明浩陈炜裴海岩薛钊坤王加
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com