Method for proliferating influenza A viruses

A type A influenza virus and influenza virus technology, applied in the field of animal infectious diseases, can solve the problems of foreign virus contamination, antigen variation, and insufficient number of chicken embryos

Inactive Publication Date: 2012-11-28
HUAZHONG AGRI UNIV +1
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the isolation or passage of influenza virus with chicken embryo allantoic fluid is easy to cause antigenic variation; there are still problems of insufficient number of chicken embryos and potential foreign virus contamination in large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for proliferating influenza A viruses
  • Method for proliferating influenza A viruses
  • Method for proliferating influenza A viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] Example 1: Isolation and Identification of Novel Type A H1N1 Influenza Virus

[0104] collection of samples

[0105]Tracheal cotton swabs of pigs suspected of swine influenza infection in a pig farm in Jiangxi Province, China were collected, and the swabs were placed in sterile saline containing 100 U / mL penicillin and streptomycin. The collected samples were immediately stored at 2-8°C, and sent for inspection within 24 hours, and stored at -70°C for long-term storage.

[0106] Virus isolation and identification

[0107] For the preparation of 80% sheets of cells, observe the growth state of the cells with a 40x microscope, select the MDCK cells in the logarithmic growth phase, pour out the cell growth solution gently, and wash the cells twice with sterilized saline to remove the cell surface newborn bovine serum. Add the cell maintenance solution containing 2 μg / mL TPCK-trypsin.

[0108] For the inoculation of cell culture wells, MDCK cells were used to isolate th...

Embodiment 2

[0154] Example 2: Whole Genome Sequencing of New Type A H1N1 Influenza Virus

[0155] Sequencing the whole genome of influenza A H1 virus, the steps are as follows:

[0156] Using the cDNA described in step 2) as a template, amplify the full length of 8 gene sequences of influenza A H1 virus, i.e. HA, M, NA, NP, NS, PA, PB1 and PB2, and the amplification obtained as sequence table SEQ The nucleotide sequence shown in ID NO: 1-8 (its sequence is such as (Genbank accession number is corresponding to JF275925-JF275932)), the nucleotide sequence of the specific primer that amplifies above-mentioned 8 genes is as follows:

[0157] Amplify the HA gene:

[0158] P15'AGCAAAAGCAGGGG 3',

[0159] P25'AGTAGAAACAAGGGTGTTTT3';

[0160] Amplify the M gene:

[0161] P15'AGCAAAAGCAGGTAG 3',

[0162] P25'AGTAGAAACAAGGTAGTTTTTT 3';

[0163] Amplify the NA gene:

[0164] P15'AGCAAAAGCAGGAGT 3'

[0165] P25'AGTAGAAACAAGGAGTTTTTT3';

[0166] Amplify the NP gene:

[0167] P15'AGCAAAAGCAGG...

Embodiment example 3

[0188] Implementation Case 3 Effects of Different Infection Doses on Proliferation of Influenza A H1 Subtype Influenza Virus in MDCK Cells

[0189] 1) In a 12-well plate, carry out the proliferation test of influenza A H1 subtype virus of different infection doses in MDCK cells, get the 12-well plate (diameter of each well of 2.2 cm, surface area of ​​3.8 cm) covered with MDCK cells 2 ), the cell density is about 2×10 5 piece / cm 2 , discard the medium, and wash 3 times with PBS buffer to remove residual medium. The concentration of H1 subtype influenza virus particles is about 1×10 7 PFU / mL. MDCK cells were inoculated respectively according to the virus multiplication of infection (Multiplication of Infection, MOI) MOI=(0.3, 0.03, 0.003), which is equivalent to HA titer of 8log 2 The virus stock solution was diluted to 10 -1 , 10 -2 , 10 -3 250 μL per well, each dose connected to 3 wells, in CO 2 Adsorbed in the incubator at 37°C for 1.5h, discarded the virus solution,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of animal infectious diseases, and in particular relates to a method for separating and identifying influenza A viruses H1 and stably proliferating the viruses on Madin-Darby canine kidney (MDCK) cells. An influenza A viruses H1 strain A-Influ / JML-F9 is obtained by separation and identification, and the collection number of the strain is CCTCC NO: V201105. The influenza A viruses H1 are stably proliferated on the MDCK cells by an optimal method, an optimal culture medium and optical culture conditions, so that the average blood congeal titer of the viruses reaches 7log2 by large-scale proliferation, and the highest blood congeal titer of the viruses reaches 9log2.

Description

technical field [0001] The invention belongs to the technical field of animal infectious diseases, and in particular relates to a method for the isolation and identification of influenza A (H1N1) virus and the stable propagation of the virus on MDCK cells. Background technique [0002] In March 2009, the first H1N1 flu case was found in Mexico. Since then, the epidemic has spread rapidly around the world and swept the world. As of August 6, 2009, more than 170 countries have reported 177,457 cases, resulting in 1,462 deaths; on August 14, 2009, my country reported 2,429 confirmed cases, and on June 11, 2009, the World Health Organization (WHO) will The pandemic alert level has been raised to level 6. The Ministry of Health of my country announced on April 30, 2009 that it would be included in the Class B infectious diseases stipulated in the "Law of the People's Republic of China on the Prevention and Control of Infectious Diseases", and adopted prevention and control measur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/00C12Q1/70C12Q1/68C12R1/93
Inventor金梅林杨影陈焕春徐高原李国红郭学波张安定周红波陈章表
OwnerHUAZHONG AGRI UNIV