Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database
A technology of Mycobacterium tuberculosis and fingerprint characteristics, applied in the biological field, can solve the problems of low characteristic map, no progress of drug resistance mutation genes, large amount of map information, etc., and achieve the effect of high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Example 1: Establishment of Mycobacterium tuberculosis Nucleic Acid Fingerprint
[0062] 1. Design and select appropriate primers
[0063] According to the 16S gene sequence (SEQ ID NO:3) of Mycobacterium tuberculosis (M. tuberculosis H37Rv), PCR primers were designed, respectively:
[0064] SEQ ID No: 1
5-cagtaatacgactcactatagggagaaggctAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)
SEQ ID No: 2
5-aggaagagagCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)
[0065]The sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the target region, and cagtaatacgactcactatagggagaaggct and aggaagagag are additional sequences added to the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains a 31bp tag (cagtaatacgactcactatagggagaaggct ), the 5' end of the primer of SEQ ID No: 2 contains a 10bp tag (aggaagagag).
[0066] Relevant primers were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0067] 2....
Embodiment 2
[0099] Example 2: Using the established Mycobacterium tuberculosis nucleic acid fingerprint feature library to identify the environmental safety of public places
[0100] At the faucets and gutters of a public kindergarten suspected of being the source of tuberculosis infection in children, the samples of the pollution source were collected, and the sample to be tested was diluted appropriately and divided into two, wherein the sample 1 to be tested was subjected to PCR amplification and enzyme After cutting, mass spectrometry detection is performed, and the whole process takes 1-2 hours.
[0101] The resulting mass spectrometry features image 3 Compared with the bacterial nucleic acid fingerprint feature library obtained in the third implementation, the judgment criteria adopted are:
[0102] When 2.300≤matching score≤3.000, it means that the reliability of strain identification is high;
[0103] When 2.000≤matching score<2.300, it means conservative genus identification o...
Embodiment 3
[0108] Embodiment 3: Biochemical analysis control experiment of sample 1 to be tested
[0109] 1. Preliminary analysis of sample 1 to be tested
[0110] 1. The isolated and cultured test sample 1 is cultured on Roche solid medium (including potato, malachite green, etc.) at 35°C for 2 weeks to produce granular or cauliflower-like milky white colonies (see Figure 4 ), pick suspicious colonies for further biochemical tests and microscopic examination.
[0111] 2. Microscopically examine the sample to be tested, and the acid-resisting smear method of lindenia sodium shows red, the bacteria are slender, the end is extremely blunt, and there is no motile spore and capsule ( Figure 5 ).
[0112] Thus, it can be preliminarily determined that the sample to be tested is Mycobacterium tuberculosis.
[0113] 2. Biochemical analysis of sample 1 to be tested
[0114] 1. Prepare Mycobacterium tuberculosis culture medium according to the following formula:
[0115]
[0116] Among t...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap