Check patentability & draft patents in minutes with Patsnap Eureka AI!

Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database

A technology of Mycobacterium tuberculosis and fingerprint characteristics, applied in the biological field, can solve the problems of low characteristic map, no progress of drug resistance mutation genes, large amount of map information, etc., and achieve the effect of high sensitivity

Active Publication Date: 2012-12-05
重庆黄嘉生物技术有限公司
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since this method uses conventional processing (treatment with absolute ethanol, formic acid and acetonitrile, supplemented by centrifugation, and finally aspirating the supernatant for detection), although it can characterize the characteristic map of the bacterium to a certain extent, it is still pending The test object contains proteins, lipids, lipopolysaccharides and lipooligosaccharides, DNA, polypeptides and other molecules that can be ionized. The amount of information in the map is too large, and the characteristic of the map is low due to the large number of molecules to be detected. It is only applicable to a specific bacterium and cannot be extended to other large numbers of bacterial detection.
[0012] Due to the above-mentioned defects in the detection of bacteria by mass spectrometry, there has been no progress in the use of mass spectrometry to detect drug-resistant mutations in bacteria and even Mycobacterium tuberculosis.
As the closest existing technology, Chinese patent application 201110178412, "Screening method for tuberculosis drug-resistant protein" reported a method for screening tuberculosis drug-resistant protein by combining SDS gel electrophoresis and mass spectrometry. After the protein is purified by gel electrophoresis, the use of liquid phase mass spectrometry to separate and identify drug-resistant proteins does not involve how to establish a library of mass spectrometry related to Mycobacterium tuberculosis and use the library for bacterial identification and typing, so the above problems cannot be solved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database
  • Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database
  • Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: Establishment of Mycobacterium tuberculosis Nucleic Acid Fingerprint

[0062] 1. Design and select appropriate primers

[0063] According to the 16S gene sequence (SEQ ID NO:3) of Mycobacterium tuberculosis (M. tuberculosis H37Rv), PCR primers were designed, respectively:

[0064] SEQ ID No: 1

5-cagtaatacgactcactatagggagaaggctAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)

SEQ ID No: 2

5-aggaagagagCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)

[0065]The sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the target region, and cagtaatacgactcactatagggagaaggct and aggaagagag are additional sequences added to the upstream and downstream PCR primers to ensure that the 5' end of the primer of SEQ ID No: 1 contains a 31bp tag (cagtaatacgactcactatagggagaaggct ), the 5' end of the primer of SEQ ID No: 2 contains a 10bp tag (aggaagagag).

[0066] Relevant primers were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.

[0067] 2....

Embodiment 2

[0099] Example 2: Using the established Mycobacterium tuberculosis nucleic acid fingerprint feature library to identify the environmental safety of public places

[0100] At the faucets and gutters of a public kindergarten suspected of being the source of tuberculosis infection in children, the samples of the pollution source were collected, and the sample to be tested was diluted appropriately and divided into two, wherein the sample 1 to be tested was subjected to PCR amplification and enzyme After cutting, mass spectrometry detection is performed, and the whole process takes 1-2 hours.

[0101] The resulting mass spectrometry features image 3 Compared with the bacterial nucleic acid fingerprint feature library obtained in the third implementation, the judgment criteria adopted are:

[0102] When 2.300≤matching score≤3.000, it means that the reliability of strain identification is high;

[0103] When 2.000≤matching score<2.300, it means conservative genus identification o...

Embodiment 3

[0108] Embodiment 3: Biochemical analysis control experiment of sample 1 to be tested

[0109] 1. Preliminary analysis of sample 1 to be tested

[0110] 1. The isolated and cultured test sample 1 is cultured on Roche solid medium (including potato, malachite green, etc.) at 35°C for 2 weeks to produce granular or cauliflower-like milky white colonies (see Figure 4 ), pick suspicious colonies for further biochemical tests and microscopic examination.

[0111] 2. Microscopically examine the sample to be tested, and the acid-resisting smear method of lindenia sodium shows red, the bacteria are slender, the end is extremely blunt, and there is no motile spore and capsule ( Figure 5 ).

[0112] Thus, it can be preliminarily determined that the sample to be tested is Mycobacterium tuberculosis.

[0113] 2. Biochemical analysis of sample 1 to be tested

[0114] 1. Prepare Mycobacterium tuberculosis culture medium according to the following formula:

[0115]

[0116] Among t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly classifying and identifying mycobacterium tuberculosis by the aid of the mass-spectrometric technique. The method includes the steps of PCR (polymerase chain reaction) amplification, SAP (severe acute pancreatitis) enzymatic digestion, transcription and nuclease digestion, purification, mass spectrometer detection and the like. A nucleic acid fingerprint spectrum database of the mycobacterium tuberculosis is established based on the method. The mycobacterium tuberculosis in samples to be detected can be rapidly identified according to mass spectrum peak diagrams generated by experiments, and results can be widely applied to typing and classification of the mycobacterium tuberculosis and the fields of environmental sanitation, public security quarantine and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for establishing a nucleic acid fingerprint of mycobacterium tuberculosis and a method for rapidly identifying mycobacterium tuberculosis using the method. Background technique [0002] Tuberculosis is a chronic infectious disease that seriously endangers people's health. At present, about 2 billion people are infected in the world. There are about 8-10 million new tuberculosis patients every year, and about 2-3 million deaths due to tuberculosis every year. At present, the annual incidence of tuberculosis in my country is about 1.3 million, and the number of deaths due to tuberculosis reaches 130,000 per year, exceeding the total number of deaths from other infectious diseases. my country is one of the 22 countries with severe tuberculosis epidemics in the world, and it is also one of the 27 countries with severe multidrug-resistant tuberculosis epidemics in the world. The n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C40B40/06C40B50/06C12Q1/68C12Q1/04C12N15/10
Inventor 马庆伟赵洪斌张海燕赵艳梅
Owner 重庆黄嘉生物技术有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More