Fusion protein of human serum albumin and lipolysis structural domain of human growth hormone

A human growth hormone and fusion protein technology, applied in the biological field, can solve the problems of difficult to exert drug effect, short half-life, easy to be hydrolyzed by oral administration, etc., and achieve the effects of being beneficial to clinical use, long half-life and low production cost

Inactive Publication Date: 2012-12-19
ZHEJIANG UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The invention provides a fusion protein of human serum albumin and human growth hormone lipolytic domain and its preparation method, which solves the problem that the existing human growth hormone lipolytic domain has a short half-life in vivo, is easily hydrolyzed when taken orally, and has a difficult drug effect. play problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of human serum albumin and lipolysis structural domain of human growth hormone
  • Fusion protein of human serum albumin and lipolysis structural domain of human growth hormone
  • Fusion protein of human serum albumin and lipolysis structural domain of human growth hormone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Cloning of HSA cDNA

[0037] HSAcDNA without signal peptide coding sequence was obtained from human fetal liver cDNA library by PCR.

[0038] The designed primers are:

[0039] HSA up: 5'ATGC GAATTC GATGCACACAAGAGTGAGGTT 3'

[0040] HSA dn: 5'ATGC GGATCC TAAGCCTAAGGCAGCTTGACT 3’

[0041] The upstream and downstream primers introduced EcoRI and BamHI sites and protective bases respectively, and the underlined part is the endonuclease recognition sequence.

[0042] PCR reaction conditions: In 100 μL reaction system, add 1.5 μL liver tissue cDNA (obtained by reverse transcription after extraction by RNA extraction kit), 1.5 μL each of 20 μmol / L upstream and downstream primers, 10 mmol / L dNTP (deoxynucleotide ) 1 μL, 10 μL of 10× reaction buffer, 0.5 μL of Taq DNA polymerase, and ddH for the rest 2 O make up.

[0043] Using EPPENDORF’s (model Matstercycler Gradient) PCR instrument, the PCR reaction conditions were pre-denaturation at 94°C for 5 min; dena...

Embodiment 2

[0046] Embodiment 2: Construction of fusion expression vector

[0047] hGH 177-191 It is the 15 AAs at the C-terminus of hGH, and its amino acid sequence is: H 2 N-Leu-Arg-Ile-Val-Gln-Cys-Arg-Ser-Val-Glu-Gly-Ser-Cys-Gly-Phe-OH. Derivation of hGH from yeast-preferred codons 177-191 The nucleotide sequence is: ctg aga atc ​​gtt cag tgc aga tct gtt gag ggt tct tgt ggt ttc, the recombinant plasmid constructed, such as figure 1 , 2 , 3 shown.

[0048] Using the pGEM-T-HSA plasmid constructed in Example 1 as a template, HSA gene and hGH were amplified in vitro by PCR 177-191 Fragment fusion gene. The fusion gene HSA-L-hGH was amplified by using primers 1 and 4 as upstream and downstream primers 177-191 , using primers 3 and 2 as upstream and downstream primers to amplify the fusion gene hGH 177-191 -HSA-hGH 177-191 . Using primers 1 and 2 as upstream and downstream primers to amplify the fusion gene HSA-hGH 177-191 .

[0049] Table 1: Primers for recombinant expression v...

Embodiment 3

[0072] Example 3 Transformation of Pichia pastoris GS115 cells, screening and expression with recombinant expression plasmids

[0073] The electroporation transformation and clone screening methods refer to the Invitrogen Pichia experimental manual, and the host cell is the Pichia GS115 strain.

[0074] Select the appropriate linearization site according to the target gene and vector, select SalI for enzyme digestion, recover the fragment containing the fusion protein gene, and use the recovered fragment to transform Pichia pastoris GS115 cells by electric shock. The transformed GS115 was spread on an RDB agar plate containing sorbitol, cultured at 30°C for 1-2 days, and His+ clones were picked. Inoculate into a 250ml Erlenmeyer flask filled with 25ml BMGY medium, culture at 30°C for 48 hours at 250 rpm to OD 600 =2~6. After centrifugation, the cells were collected to make OD with BMMY medium 600 = about 1.0 (the amount of BMMY medium is about 100-200 mL), continue to cultu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion protein of human serum albumin and lipolysis structural domain of human growth hormone. The fusion protein comprises two regions. The first region is the human serum albumin while the second region is the lipolysis structural domain of the human growth hormone. The amino acid sequence of the lipolysis structural domain of the human growth hormone is LRIVQCRSVEGSCGF. The fusion protein provided by the invention uniquely has the activity for promoting lipolysis. The half-life period of the fusion protein in human body is longer. The fusion protein expressed in yeast is free from renaturation and convenient to purify. The purifying step is concise and efficient. The endotoxin content of a final product is low so that the fusion protein is beneficial for clinical use. The production cost of recombinant expression is lower and the efficiency is high.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a fusion protein of human serum albumin and human growth hormone lipolysis domain. Background technique [0002] Human growth hormone (hGH) is a protein hormone secreted by pituitary eosinophils. The functions of hGH are complex and diverse. It can regulate the growth and development of the human body and affect the metabolism of proteins, carbohydrates and fats. Recombinant hGH is a clinically very important drug, which is used to treat hGH deficiency in adults and children in physiological doses; it is used to treat many diseases in pharmacological doses, such as osteoporosis, heart failure, chronic kidney disease exhaustion, Turner's syndrome, and various acute and chronic metabolic diseases. [0003] The function of hGH in the body is mainly through the combination with the receptor, and the growth hormone receptor (growth hormone receptor, GHR) is widely distributed in the bod...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N15/81C12N1/19
Inventor陈枢青王芙蓉吴敏沈其
OwnerZHEJIANG UNIV