AKT3 gene mutation detection specificity primer and liquid chip thereof
A detection solution and specificity technology, which is applied in the field of molecular biology, can solve problems such as unusable and unsuitable for practical applications, and achieve the effects of increased sensitivity, accurate and reliable detection results, and overcoming low sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 AKT3 gene mutation detection liquid chip mainly includes:
[0020] 1. ASPE Primers
[0021] Specific primer sequences were designed for the wild-type and mutant types of the common genotype G171R of the AKT3 gene. ASPE primers consist of "tag sequence + specific primer sequence". ASPE primer sequences are shown in the table below:
[0022] Table 1 The tag sequence in the ASPE primer sequence of AKT3 gene
[0023] SEQ ID NO.
tag sequence
[0024] 1
CAATAAACTATACTTCTTCACTAA
2
TCAAAATCTCAAATACTCAAATCA
3
CTTTTCAATTACTTCAAATCTTCA
4
ATTATTCACTTCAAACTAATCTAC
5
CTTTTCATCTTTTCATCTTTCAAT
6
CTTTCAATTACAATACTCATTACA
[0025] Table 2 The specific primer sequence in the ASPE primer sequence of AKT3 gene
[0026]
[0027] Each ASPE primer includes two parts, the 5' end is a specific tag sequence for the anti-tag sequence on the corresponding microsphere, and the...
Embodiment 2
[0040] Example 2 Detection of samples using AKT3 gene detection liquid chip
[0041] The formula of described various solutions is as follows:
[0042] 50mM MES buffer (pH5.0) formula (250ml):
[0043]
[0044] 2×Tm hybridization buffer
[0045] Reagent
[0046] Store at 4°C after filtration.
[0047] ExoSAP-IT kit was purchased from US USB Company.
[0048] Biotin-labeled dCTP was purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0049] 1. Sample DNA extraction:
[0050] Refer to the relevant methods of DNA extraction in "Molecular Cloning" to obtain the DNA to be detected.
[0051] 2. PCR amplification of samples to be tested
[0052] A pair of primers were designed, and a target sequence containing the common genotype G171R of the AKT3 gene was amplified by PCR. The product sizes were 388bp. The primer sequences (SEQ ID NO.7-8) are shown in Table 4 above.
[0053] First prepare the multiplex PCR primer working solution: take 100u...
Embodiment 3
[0089] Example 3 Detection of AKT3 gene SNP site by liquid chip with different ASPE primers
[0090] 1. Design of liquid phase chip preparation (selection of tag sequence and Anti-tag sequence)
[0091] Taking the AKT3 gene G171R site mutation detection liquid chip as an example, the specific primer sequence of the 3' end of the ASPE primer was designed for the wild type and mutant type of G171R, and the tag sequence of the 5' end of the ASPE primer was selected from SEQ ID NO.1 - SEQ ID NO.6, correspondingly, the anti-tag sequence coated on the microspheres and complementary to the corresponding tag sequence is selected from SEQ ID NO.9-SEQ ID NO.14. The specific design is shown in the following table (Table 8). The synthesis of ASPE primers, microspheres coated with anti-tag sequences, amplification primers, detection methods, etc. are as described in Example 1 and Example 2.
[0092] Table 8 Design of liquid phase chip preparation
[0093]
[0094]
[0095] 2. Samp...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap