Unlock instant, AI-driven research and patent intelligence for your innovation.

Reconstructed nucleic acid construction and method for quickly recycling amino acid composition by using reconstructed nucleic acid construction

A technology for constructs and amino acids, which is applied in the field of recombinant nucleic acid constructs and the rapid recovery of amino acid compositions using the recombinant nucleic acid constructs, can solve the problems that cells are not easy to amplify and culture, leak, and limit applicability, etc. Achieve the effect of improving purification efficiency, reducing investment and simplifying processing procedures

Inactive Publication Date: 2013-04-10
FENG CHIA UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] On the other hand, Miksch et al. use the function of the kil gene to release the protein produced in the intercellular membrane (Appl.Mirobiol.Biotechnol., 1997, 47:530-536) to produce glucanase β- glucanase as an example, the results show that this technology does not cause cell rupture, but can release the glucanase produced in the intercellular membrane in the extracellular fermentation broth; however, the intercellular membrane is located in the outer and inner membranes of E. coli Because the cytoplasmic space is much larger than the intermembrane space, the protein to be produced can be accumulated and produced in a large amount in the cytoplasm compared with the intermembrane space; and the kil gene product can help the release of intermembrane proteins, which means The structure of the outer membrane of the cell is changed to cause leakage. Therefore, under the condition of huge shear stress generated by industrial fermentation scale, the cells are not easy to scale up and culture, which limits the applicability of this technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reconstructed nucleic acid construction and method for quickly recycling amino acid composition by using reconstructed nucleic acid construction
  • Reconstructed nucleic acid construction and method for quickly recycling amino acid composition by using reconstructed nucleic acid construction
  • Reconstructed nucleic acid construction and method for quickly recycling amino acid composition by using reconstructed nucleic acid construction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of temperature-induced recombinant nucleic acid construct pPL-Φxe

[0033] temperature-inducible recombinant nucleic acid construct Contains λP R P L The bacteriophage φX174 lytic gene E (φXe) driven by the promoter (promoter) expression, multiple cloning sites, receptor P RM Promoter-regulated heat-sensitive repressor protein (heat-sensitive repressor protein) CI857 gene, pMB1 plastid replication origin from Escherichia coli, and ampicillin-resistant gene. The construction process is as follows. Firstly, the φXe gene primer is synthesized according to the nucleotide sequence of φXe (Refseq: NC 001422) in the genome database of the National Center for Biotechnology Information (NCBI) in the United States:

[0034] Forward introduction:

[0035] (5'TTGCG CATATG GTACGCTGGACTTGTG3')

[0036] Reverse Primer:

[0037] (5'TTTT GAATTC AGACATTTTATTCACTCCTTCCGCACG3')

[0038] The forward primer was designed to contain the cleavage site of rest...

Embodiment 2

[0039] Example 2: Construction of a temperature-induced recombinant nucleic acid construct

[0040] temperature-inducible recombinant nucleic acid construct Contains λP R P L Promoter-driven expression of φXe, diverse clonal positions, regulated by mutant P RM Promoter (P RM *) Regulated thermosensitive inhibitory protein CI857 gene, pMB1 plastid replication region from E. coli, ampicillin resistance gene. According to published literature (Jechlinger W. et al., 2005, J.Biotechnol.116: 11-20), P RM * Promoter strength is higher than that of P RM Promoter enhancement, thus increasing the expression of the heat-sensitive inhibitory protein CI857 gene, to effectively repress λP R P L Expression of the promoter in the uninduced state. The construction process is as follows. Firstly, point mutation primers were designed according to the pPL452 sequence (GenBank: AB248920.1) of the Genome Database of the National Center for Biotechnology Information. The primer sequence...

Embodiment 3

[0046] Example 3: Construction of a temperature-induced recombinant nucleic acid construct

[0047] temperature-inducible recombinant nucleic acid construct Contains λP R P L Promoter-driven expression of φXe and phage (phage) T4 lysin gene (Gpe), regulated by P RM * Regulated thermosensitive inhibitory protein CI857 gene, a lacO operator site, pSC101 plastid replication region, streptomycin resistance gene. The construction process is as follows. First, the primer sequence is designed according to the position of the lacO control subunit in the genome database of the National Center for Biotechnology Information:

[0048] Forward introduction:

[0049] (5' GGATAACAATT GATCCTAAGGAGGTTGATCC3')

[0050] Reverse Primer:

[0051] (5' GCTCACAATT CCAATGCTTCGTTTCGTATCACACACC3')

[0052] The above primer pair contains a lacO control sub-position (as indicated by the underline), and the plastid constructed in Example 2 As a DNA template, use PCR amplification reaction, us...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a nucleic acid construction which is adjustable and can effectively breaks bacterial strains to release the recombinant protein in a bacterial strain cell out of the cell, thereby realizing the aim of convenient and fast recycling of the amino acid composition. The nucleic acid construction includes a nucleic acid for controlling an expressed gene and a gene product being expressed through induction; wherein the nucleic acid for controlling an expressed gene includes a heat-sensitive repressor protein) CI857 gene, a gamma PRPL promoter, a heat shock protein groEL promoter, and a lacO operator site. The gene product being expressed through induction includes a phage phiX174 lysis gene E and a phage T4 lysosome gene or a T7 lysosome gene. Taking the productions of Agrobacterium radiobacter NRRL B 1129 lamidohydrolase (AHL) and hydantoinase (HDT) as embodiments, the produced bacterial strain is provided with the nucleic acid construction, the produced bacterial strain stops growing immediately once the temperature induction is taken the effect, and the reconstructed AHL and HDT produced by induction can be effectively released out of the cell.

Description

technical field [0001] The present invention relates to a recombinant nucleic acid construct and a method for rapidly recovering amino acid composition using the recombinant nucleic acid construct, in particular to a rapid recovery of Escherichia coli from the culture medium in the industrial process for producing recombinant proteins in Escherichia coli The method of releasing the protein. Background technique [0002] The ultimate goal of the Human Genome Project is to draw out the basic blueprint of life, so that human beings can use it to understand physiological functions and spy on the mysteries of life; on the other hand, scientists can also use this map to decipher human genes The mystery, and the use of biological key technologies to solve the problem of human genetic diseases, and the development of related biotechnology to promote the future well-being of human beings. Due to the smooth promotion of this greatest human project in the 21st century, it has also pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12R1/19
Inventor 赵云鹏张智翔姜中人
Owner FENG CHIA UNIVERSITY