Engineering bacteria producing DL-alanine and method of producing DL-alanine by using engineering bacteria

A technology of engineering bacteria and alanine, applied in the field of DL-alanine production, can solve problems such as being difficult to realize industrialized production, and achieve the effect of simple process

Active Publication Date: 2013-04-17
ANHUI HUAHENG BIOTECH
View PDF3 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore this scheme is also not easy to realize industrialized production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria producing DL-alanine and method of producing DL-alanine by using engineering bacteria
  • Engineering bacteria producing DL-alanine and method of producing DL-alanine by using engineering bacteria
  • Engineering bacteria producing DL-alanine and method of producing DL-alanine by using engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1X

[0032] Construction of embodiment 1XZ-A30 bacterial strain

[0033] The construction of the XZ-A30 strain includes two steps (a) and (b), the specific operations are as follows:

[0034] (a) Cloning and integration of alanine racemase gene

[0035] The cloning and integration of alanine racemase gene alaR are divided into the following two steps:

[0036] (a1) Cloning of alaR gene

[0037] Take Bacillus subtilis 168 (Moszer I, Jones LM, Moreira S, Fabry C, Danchin A. SubtiList: the reference database for the Bacillus subtilis genome. Nucleic Acids Res. 2002, 30 (1): 62-65. Publicly available from Anhui Huaheng Bioengineering Co., Ltd.) genomic DNA was used as a template, and primers alaR up-XbaI / alaR down-SalI were used to amplify the alanine racemase gene alaR (SEQ ID NO: 14) of Bacillus subtilis. The primer sequences are:

[0038] alaR up-XbaI: GGAGAGTCTAGAATGAGCACAAAACCTTT (SEQ ID NO: 1);

[0039] alaR down-SalI: CGCTGCGTCGACTTAATTGCTTATATTTACC (SEQ ID NO: 2).

[0040...

Embodiment 2

[0079] Embodiment 2 produces DL-alanine with XZ-A30 bacterial strain anaerobic fermentation

[0080] Both the seed medium and the fermentation medium consist of: glucose 120g / L, ammonium chloride 4g / L, NaH 2 PO 4 5g / L, Na 2 HPO 4 5g / L, MgSO 4 ·7H 2 O1g / L, CaCl 2 2H 2 O 0.1g / L, trace inorganic salt 4ml / L, medium pH 6.5. The composition of trace inorganic salts is: FeCl 3 ·6H 2 O 1.5 mg, CoCl 2 ·6H 2 O 0.1 mg, CuCl 2 2H 2 O 0.1mg, ZnCl 2 0.1 mg, Na 2 MoO 4 2H 2 O 0.1 mg, MnCl 2 4H 2 o 2 0.2mg, dilute to 1L with distilled water, and filter to sterilize.

[0081] 150ml of seed culture medium in a 250ml Erlenmeyer flask, sterilized at 121°C for 15min. After cooling, insert XZ-A30, culture temperature is 30°C, shaker speed is 50r / min (50 revolutions / min), culture for 18h, used for fermentation medium inoculation.

[0082] The volume of the fermentation medium in a 3L fermenter is 2.4L, and it is sterilized at 121°C for 15min. The inoculum size is 0.1% (V / V,), ...

Embodiment 3

[0085] Embodiment 3 produces DL-alanine with XZ-A30 bacterial strain anaerobic fermentation

[0086] Both the seed medium and the fermentation medium consist of: glucose 120g / L, ammonium chloride 4g / L, NaH 2 PO 4 5g / L, Na 2 HPO 4 5g / L, MgSO 4 ·7H 2 O1g / L, CaCl 2 2H 2 O 0.1g / L, trace inorganic salt 4ml / L, medium pH 6.5. The composition of trace inorganic salts is: FeCl 3 ·6H 2 O 1.5 mg, CoCl 2 ·6H 2 O 0.1 mg, CuCl 2 2H 2 O 0.1mg, ZnCl 2 0.1 mg, Na 2 MoO 4 2H 2 O 0.1 mg, MnCl 2 4H 2 o 2 0.2mg, dilute to 1L with distilled water, and filter to sterilize.

[0087] 150ml of seed culture medium in a 250ml Erlenmeyer flask, sterilized at 121°C for 15min. After cooling, insert XZ-A30, culture temperature is 30°C, shaker speed is 50r / min (50 revolutions / min), culture for 18h, used for fermentation medium inoculation.

[0088] The volume of the fermentation medium in a 3L fermenter is 2.4L, and it is sterilized at 121°C for 15min. The inoculum size is 0.1% (V / V,), ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain of engineering bacteria producing DL-alanine. Lactic dehydrogenase, pyruvate formate lyase, alcohol dehydrogenase, acetic acid kinase, fumaric acid reductase, alanine racemase and methyl glyoxal synthetase of the strain of engineering bacteria producing the DL-alanine are inactivated; and exogenous L-alanine dehydrogenase gene and alanine racemase gene are integrated on the chromosome of the engineering bacteria. According to the invention, pyroracemic acid, an intermediate product of the glycolysis is converted to L-alanine by integrating the exogenous L-alanine dehydrogenase gene into the chromosome of the engineering bacteria; and an exogenous alanine racemase gene is further integrated into the chromosome, and part of the L-alanine is converted into D-alanine. Then producing the DL-alanine from raw material sugar in one step is realized, the production period of the DL-alanine is decreased and the productivity of the DL-alanine is enhanced.

Description

technical field [0001] The invention relates to the field of DL-alanine production, in particular to a method for producing DL-alanine and using the engineering bacteria to produce DL-alanine. Background technique [0002] DL-alanine is mainly used in the food processing industry as a nutritional supplement and seasoning. It has a good umami taste and can enhance the seasoning effect of the seasoning. Secondly, it is used in the pharmaceutical industry to synthesize some pesticides, medicines and pharmaceutical intermediates. [0003] At present, the production of DL-alanine is mainly produced by enzyme-catalyzed technology (alanine racemase) or chemical racemization method, and the chemical racemization method needs to use organic acid as a solvent, which has pollution to the environment and yield bias. Low-level shortcomings, so it is gradually eliminated. Enzyme-catalyzed technology is to ferment glucose to produce L-alanine first, and then convert L-alanine into D-alan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/06C12R1/19
Inventor张学礼张冬竹
OwnerANHUI HUAHENG BIOTECH