Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetically engineered bacterium for expressing solubility pig gamma-interferonPoIFN-gamma and construction method and application of genetically engineered bacterium

The technology of a genetically engineered bacteria and a construction method is applied to the genetically engineered bacteria expressing soluble porcine interferon γ-interferon PoIFN-γ and the field of its construction, and can solve the problems of inactive inclusion bodies of the product, complicated and tedious preparation process, low expression level and the like.

Active Publication Date: 2013-06-12
JIANGSU HFQ BIO TECH CO LTD
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention overcomes the defects of low expression of porcine gamma-interferon prepared by the above-mentioned prior art, the product is an inactive inclusion body, complex and cumbersome preparation process, etc., and proposes a genetically engineered bacterium expressing soluble porcine gamma-interferon and its construction method, and the efficient preparation method of porcine gamma-interferon by using the genetically engineered bacteria; by adopting self-induction medium to ferment and express porcine gamma-interferon, steps such as monitoring the cell density and adding IPTG inducer are omitted, making the operation Simple and easy to implement, while avoiding the toxic effect of IPTG on the bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for expressing solubility pig gamma-interferonPoIFN-gamma and construction method and application of genetically engineered bacterium
  • Genetically engineered bacterium for expressing solubility pig gamma-interferonPoIFN-gamma and construction method and application of genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Construction of genetically engineered bacteria expressing soluble porcine gamma-interferon

[0042] Step 1: artificial synthesis of PoIFN-γ gene (SEQ ID NO.4)

[0043] Referring to the comprehensive factors such as Escherichia coli BL21 (DE3)'s preference for amino acid codons, base GC content, and mRNA secondary structure, the nucleotide sequence of natural porcine gamma-interferon is optimized. The amino acid sequence of γ-interferon, and the porcine γ-interferon mature peptide gene that can be expressed efficiently in Escherichia coli BL21 (DE3), its sequence (SEQ ID NO.1) is as follows:

[0044] CAGGCGCCGTTTTTTAAAGAAATTACCATTCTGAAAGATTATTTTAATGCGAGCACCAGCGATGTGCCGAATGGCGGCCCGCTGTTTCTGGAAATTCTGAAAAATTGGAAAGAAGAAAGCGATAAAAAAATTATTCAGAGCCAGATTGTGAGCTTTTATTTTAAATTTTTTGAAATT TTTAAAGATAATCAGGCGATTCAGCGCAGCATGGATGTGATTAAACAGGATATGTTTCAGCGCTTTCTGAATGGCAGCAGCGGCAAACTGAATGATTTTGAAAAACTGATTAAAATTCCGGTGGATAATCTGCAGATTCAGCGCAAAGCGATTAGCGAACTGATTAAAGTGATGAATGATCTGAGCCC...

Embodiment 2

[0050] Embodiment 2 prepares porcine gamma-interferon

[0051] The strain used in this example is: pET-32a(+)-PoIFN-γ / pTf16-P araB -tig / BL21(DE3) co-expressed genetically engineered bacteria.

[0052] The formulation of the self-inducing medium used in this example is: glycerol 0.5% (v / v), tryptone 1% (w / v), yeast extract 0.5% (w / v), lactose 0.2% (w / v ), glucose 0.05% (w / v), NaCl 0.5% (w / v), Na 2 HPO 4 50mM, KH 2 PO 4 50mM, (NH 4 ) 2 SO 4 25mM, MgSO 4 2mM.

[0053]The specific process of culture and fermentation is as follows: first, the preserved strain pET-32a(+)-PoIFN-γ / pTf16-P araB -tig / BL21(DE3) was inoculated on the LB plate containing ampicillin and chloramphenicol, cultured overnight at 37°C, and then a single colony was picked from the plate, and inoculated on an autoinduced plate containing ampicillin and chloramphenicol. In the culture medium, culture at 27° C. and 210 rpm for 18 hours, and collect the cells by centrifugation.

[0054] Preparation of por...

Embodiment 3

[0064] Embodiment 3 comprises the preparation of the composition of porcine gamma-interferon

[0065] Prepare 0.9% (w / v) NaCl solution, take 1mg of purified porcine γ-interferon PoIFN-γ and dissolve it in 0.5ml NaCl solution; take another 50mg mannitol and dissolve it in 0.5ml NaCl solution; mix the two It is the composition of porcine γ-interferon PoIFN-γ and mannitol, which contains 1 mg / ml of PoIFN-γ and 50 mg / ml of mannitol.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering, and specifically discloses a genetically engineered bacterium for expressing solubility pig gamma-interferonPoIFN-gamma and construction method and application of the genetically engineered bacterium. The genetically engineered bacterium for expressing solubility pig gamma-interferonPoIFN-gamma is Escherichia coil BL21(DE3) carrying recombinant plasmid Pet-32a(+)-PoIFN-gamma and plasmid pTf16-ParaB-tig simultaneously, wherein the PoIFN-gamma gene sequence in the recombinant plasmid Pet-32a(+)-PoIFN-gamma is SEQ ID NO.4, and the plasmid pTf16-ParaB-tig can express the molecular chaperone tig. The method disclosed by the invention is capable of improving the solubility and output of the pig gamma-interferon, simple in process and low in cost, and has good industrial application value.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a genetically engineered bacterium expressing soluble porcine gamma-interferon PoIFN-γ, its construction method and application. Background technique [0002] Porcine interferon gamma (porcine interferon gamma, PoIFN-γ), also known as porcine type II interferon, is a type of cytokine secreted by activated T lymphocytes, macrophages and NK cells, etc. , Activation of lymphocytes and immune regulation and other functions. In practical applications, porcine interferon is used as a vaccine adjuvant and used in combination with vaccines for treating different diseases to develop a new type of vaccine with better immune effect, which has a positive impact on the prevention and treatment of pig diseases. [0003] At present, the mass production of porcine interferon mainly includes cell induction culture method and gene recombination method using Pichia pastoris...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/66C12N15/63C12P21/02A61K38/21A61P31/12C12R1/19
Inventor 龙谭汪正华吴自荣郗洪生王滨坤
Owner JIANGSU HFQ BIO TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com