Genetically engineered bacterium for expressing solubility pig gamma-interferonPoIFN-gamma and construction method and application of genetically engineered bacterium
The technology of a genetically engineered bacteria and a construction method is applied to the genetically engineered bacteria expressing soluble porcine interferon γ-interferon PoIFN-γ and the field of its construction, and can solve the problems of inactive inclusion bodies of the product, complicated and tedious preparation process, low expression level and the like.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Construction of genetically engineered bacteria expressing soluble porcine gamma-interferon
[0042] Step 1: artificial synthesis of PoIFN-γ gene (SEQ ID NO.4)
[0043] Referring to the comprehensive factors such as Escherichia coli BL21 (DE3)'s preference for amino acid codons, base GC content, and mRNA secondary structure, the nucleotide sequence of natural porcine gamma-interferon is optimized. The amino acid sequence of γ-interferon, and the porcine γ-interferon mature peptide gene that can be expressed efficiently in Escherichia coli BL21 (DE3), its sequence (SEQ ID NO.1) is as follows:
[0044] CAGGCGCCGTTTTTTAAAGAAATTACCATTCTGAAAGATTATTTTAATGCGAGCACCAGCGATGTGCCGAATGGCGGCCCGCTGTTTCTGGAAATTCTGAAAAATTGGAAAGAAGAAAGCGATAAAAAAATTATTCAGAGCCAGATTGTGAGCTTTTATTTTAAATTTTTTGAAATT TTTAAAGATAATCAGGCGATTCAGCGCAGCATGGATGTGATTAAACAGGATATGTTTCAGCGCTTTCTGAATGGCAGCAGCGGCAAACTGAATGATTTTGAAAAACTGATTAAAATTCCGGTGGATAATCTGCAGATTCAGCGCAAAGCGATTAGCGAACTGATTAAAGTGATGAATGATCTGAGCCC...
Embodiment 2
[0050] Embodiment 2 prepares porcine gamma-interferon
[0051] The strain used in this example is: pET-32a(+)-PoIFN-γ / pTf16-P araB -tig / BL21(DE3) co-expressed genetically engineered bacteria.
[0052] The formulation of the self-inducing medium used in this example is: glycerol 0.5% (v / v), tryptone 1% (w / v), yeast extract 0.5% (w / v), lactose 0.2% (w / v ), glucose 0.05% (w / v), NaCl 0.5% (w / v), Na 2 HPO 4 50mM, KH 2 PO 4 50mM, (NH 4 ) 2 SO 4 25mM, MgSO 4 2mM.
[0053]The specific process of culture and fermentation is as follows: first, the preserved strain pET-32a(+)-PoIFN-γ / pTf16-P araB -tig / BL21(DE3) was inoculated on the LB plate containing ampicillin and chloramphenicol, cultured overnight at 37°C, and then a single colony was picked from the plate, and inoculated on an autoinduced plate containing ampicillin and chloramphenicol. In the culture medium, culture at 27° C. and 210 rpm for 18 hours, and collect the cells by centrifugation.
[0054] Preparation of por...
Embodiment 3
[0064] Embodiment 3 comprises the preparation of the composition of porcine gamma-interferon
[0065] Prepare 0.9% (w / v) NaCl solution, take 1mg of purified porcine γ-interferon PoIFN-γ and dissolve it in 0.5ml NaCl solution; take another 50mg mannitol and dissolve it in 0.5ml NaCl solution; mix the two It is the composition of porcine γ-interferon PoIFN-γ and mannitol, which contains 1 mg / ml of PoIFN-γ and 50 mg / ml of mannitol.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
