Sphingomonas alginate lyase gene ZH0-III as well as prokaryotic expression vector and application thereof
A technology of ZH0-III and alginate lyase, which is applied in prokaryotic expression vectors and the application field of preparing alginate lyase ZH0-III protein, can solve the problem of difficult separation of enzymes and degradation products, low enzyme production of wild bacteria, and limitations Promote the use and other issues to achieve the effect of broad substrate specificity, broad application prospects, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Sphingomonas Sphingomonas Preparation and detection of sp. ZH0 (ZH0) genomic DNA
[0040] Sphingomonas used in the present invention Sphingomonas sp. ZH0 (ZH0) is the strain screened by our laboratory. Genomic DNA of Sphingomonas ZH0 was prepared by the extraction method of common bacterial genome. Use up the supernatant and collect the bacteria; add 100ul Solution I suspension bacteria; 30ul 10%SDS; 1ul 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100ul 15mol / L NaCl, mix well; add 20ul CTAB / NaCl solution (CTAB 10%, NaCl 0.7mol / L), mix well, 65°C, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol 25:24:1) and mix; centrifuge at 12000rpm, 5 minutes; take For the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3mol / L NaOAC, and place it at -20°C for 30 minutes; centrifuge at 12,000rpm for 10 minutes; add 70% ethanol to the precipitate to wash; after the precipitate is dried, diss...
Embodiment 2
[0041] Example 2: Alginate Lyase Gene ZH0-III Amplification and TA cloning:
[0042] alginate lyase gene ZH0-III Amplification and TA cloning strategies such as figure 2 As shown, a pair of specific primers were designed according to the conserved sequence of the N-terminal and C-terminal of the alginate lyase family of Sphingomonas, the sequence is as follows:
[0043] ZH0-3-F: GGATCCCACCCCTTCGACCAGGCCGTCGTG
[0044] ZH0-3-R: GCGGCCGCTCATGCCGTCGGAGCTTGCGCTGC
[0045] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCC characteristic sequence, forming the Not I restriction site.
[0046] Add 10ng of Sphingomonas ZH0 genomic DNA to the PCR reaction mixture as a template, and at the same time add 50ng of specific primers ZH0-3-F and ZH0-3-R, 1.8uldNTP (10mM), 2.5ul of Pfu Reaction Buffer and 0.15ul pfu (5U / ul) polymerase (Beijing Zhuangmeng International Biogene Technology Co., Ltd.), add double ...
Embodiment 3
[0047] Example 3: Prokaryotic expression vector pGEX-4T-1- ZH0-III build
[0048] pGEX-4T-1- ZH0-III A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19- ZH0-III , separated the cleaved vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19- ZH0-III produced by cutting ZH0-III The DNA fragment (1.0kb) of the gene, and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and ZH0-III The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- ZH0-III , use the ligation reaction mixture to transform high-efficiency (108) E. coli competent cells (JM109, Beijing Zhuangmeng International Biogene Technology Co., Ltd.), and apply the transformed E. coli to ampicillin (Amp, 100ug / ml) On a plate, cultivate overnight at 37°C, screen the Amp-resistant recombinant colony, extract the p...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap