Unlock instant, AI-driven research and patent intelligence for your innovation.

Sphingomonas alginate lyase gene ZH0-III as well as prokaryotic expression vector and application thereof

A technology of ZH0-III and alginate lyase, which is applied in prokaryotic expression vectors and the application field of preparing alginate lyase ZH0-III protein, can solve the problem of difficult separation of enzymes and degradation products, low enzyme production of wild bacteria, and limitations Promote the use and other issues to achieve the effect of broad substrate specificity, broad application prospects, and easy operation

Inactive Publication Date: 2013-06-26
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are many types of alginate-decomposing bacteria found at home and abroad, mainly distributed in marine bacteria, soil bacteria and fungi, etc., but there are not many alginate lyases that have been successfully cloned and heterologously expressed. Traditional methods generally use alginate Sodium-decomposing bacteria can be separated and purified to obtain alginate lyase by fermentation. However, this method has problems such as low enzyme production by wild bacteria, difficulty in separating enzymes from degradation products, and high production costs. The restrictive technical problem of sugar limits the popularization and use of alginate lyase, and most alginate lyases can only use PloyG or PloyM in a single way. Sphingomonas sp. The alginate lyase gene was successfully cloned in .ZH0 ZH0-III , and carried out research on heterologous expression and protein purification, which will lay the foundation for further research on the molecular mechanism of alginate lyase, and then be extended to industrial production. The recombinant alginate lyase obtained in the present invention ZH0-III It has a wide range of substrate specificity, can use both PloyG and PloyM as substrates, and is a bifunctional enzyme with broad application prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sphingomonas alginate lyase gene ZH0-III as well as prokaryotic expression vector and application thereof
  • Sphingomonas alginate lyase gene ZH0-III as well as prokaryotic expression vector and application thereof
  • Sphingomonas alginate lyase gene ZH0-III as well as prokaryotic expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Sphingomonas Sphingomonas Preparation and detection of sp. ZH0 (ZH0) genomic DNA

[0040] Sphingomonas used in the present invention Sphingomonas sp. ZH0 (ZH0) is the strain screened by our laboratory. Genomic DNA of Sphingomonas ZH0 was prepared by the extraction method of common bacterial genome. Use up the supernatant and collect the bacteria; add 100ul Solution I suspension bacteria; 30ul 10%SDS; 1ul 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100ul 15mol / L NaCl, mix well; add 20ul CTAB / NaCl solution (CTAB 10%, NaCl 0.7mol / L), mix well, 65°C, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol 25:24:1) and mix; centrifuge at 12000rpm, 5 minutes; take For the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3mol / L NaOAC, and place it at -20°C for 30 minutes; centrifuge at 12,000rpm for 10 minutes; add 70% ethanol to the precipitate to wash; after the precipitate is dried, diss...

Embodiment 2

[0041] Example 2: Alginate Lyase Gene ZH0-III Amplification and TA cloning:

[0042] alginate lyase gene ZH0-III Amplification and TA cloning strategies such as figure 2 As shown, a pair of specific primers were designed according to the conserved sequence of the N-terminal and C-terminal of the alginate lyase family of Sphingomonas, the sequence is as follows:

[0043] ZH0-3-F: GGATCCCACCCCTTCGACCAGGCCGTCGTG

[0044] ZH0-3-R: GCGGCCGCTCATGCCGTCGGAGCTTGCGCTGC

[0045] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCC characteristic sequence, forming the Not I restriction site.

[0046] Add 10ng of Sphingomonas ZH0 genomic DNA to the PCR reaction mixture as a template, and at the same time add 50ng of specific primers ZH0-3-F and ZH0-3-R, 1.8uldNTP (10mM), 2.5ul of Pfu Reaction Buffer and 0.15ul pfu (5U / ul) polymerase (Beijing Zhuangmeng International Biogene Technology Co., Ltd.), add double ...

Embodiment 3

[0047] Example 3: Prokaryotic expression vector pGEX-4T-1- ZH0-III build

[0048] pGEX-4T-1- ZH0-III A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19- ZH0-III , separated the cleaved vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19- ZH0-III produced by cutting ZH0-III The DNA fragment (1.0kb) of the gene, and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and ZH0-III The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- ZH0-III , use the ligation reaction mixture to transform high-efficiency (108) E. coli competent cells (JM109, Beijing Zhuangmeng International Biogene Technology Co., Ltd.), and apply the transformed E. coli to ampicillin (Amp, 100ug / ml) On a plate, cultivate overnight at 37°C, screen the Amp-resistant recombinant colony, extract the p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sphingomonas alginate lyase gene ZH0-III and an efficient prokaryotic expression vector pGEX-4T-1-ZH0-II thereof. A Ptac promoter is utilized to control the expression of the prokaryotic expression vector pGEX-4T-1-ZH0-II in colon bacillus. The expression of the alginate lyase gene is performed by the colon bacillus expression vector, so that the alginate lyase ZH0-III as an express product can be obtained in a short time. The obtained recombinant alginate lyase gene ZH0-III is wide in substrate specificity, wherein the PloyG or the PloyM can be served as a substrate; and the enzyme activity can reach 63.8U / mg. The prokaryotic expression vector and the overall expression system are easy to operate, and are convenient for industrialized production.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to a sphingomonas alginate lyase gene ZH0-III and its prokaryotic expression vector pGEX-4T-1- ZH0-II and its application in preparing alginate lyase ZH0-III protein. Background technique [0002] In recent years, due to the aggravation of the energy crisis and the increasingly prominent environmental problems, more and more attention has been paid to the production of bioenergy from seaweed biomass. Macroalgae are rich in carbohydrates, such as alginic acid, and the corresponding technology can be developed to convert it into bioethanol with high yield and easy pretreatment. At present, the methods of alginic acid degradation can be divided into three categories: one is the chemical degradation method, and the acid hydrolysis method is widely used at present. This method has cumbersome operation steps and severe reaction conditions. In addition, there is hydrogen pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N15/70C12N9/88C12R1/01
Inventor 伊日布斯过敏钱龙赵琳唐丽薇严金平
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More