Prokaryotic expression vector of sphingomonassp.ZHO alginate lyase ZHO-I and application thereof

A technology of alginate lyase and Sphingomonas, which is applied in the direction of lyase, application, and introduction of foreign genetic material by using vectors, etc., which can solve the problem of difficult separation of enzyme and degradation products, low enzyme production of wild bacteria, and limited promotion Use and other issues to achieve the effect of broad substrate specificity, broad application prospects, and easy operation

Inactive Publication Date: 2013-07-24
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are many types of alginic acid decomposing bacteria found at home and abroad, mainly distributed in marine bacteria, soil bacteria and fungi, etc., but they have been successfully cloned and heterologously expressed There are not many alginate lyases. The traditional method generally uses sodium alginate decomposing bacteria to separate and purify alginate lyase through fermentation. However, this method has low enzyme production in wild bacteria and is difficult to separate enzymes from degradation products. The problem of high production cost has become a restrictive technical problem for enzymatic hydrolysis technology to prepare a large number of alginate oligosaccharides, which limits the popularization and use of alginate lyase, and most alginate lyase can only use PloyG or PloyM alone. The present invention The alginate lyase gene ZH0-I was successfully cloned from Sphingomonas Sphingomonas sp.ZH0, and the heterologous expression and protein purification were carried out. It will lay the foundation for further research on the molecular mechanism of alginate lyase, and then promote it to industrial production. The recombinant alginate lyase ZH0-I obtained by the present invention has a wide range of substrate specificity, and can use both PloyG and PloyM as substrates. is a bifunctional enzyme with broad application prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prokaryotic expression vector of sphingomonassp.ZHO alginate lyase ZHO-I and application thereof
  • Prokaryotic expression vector of sphingomonassp.ZHO alginate lyase ZHO-I and application thereof
  • Prokaryotic expression vector of sphingomonassp.ZHO alginate lyase ZHO-I and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Sphingomonas Sphingomonas sp. . Preparation and detection of ZH0 genomic DNA

[0042] Sphingomonas used in the present invention Sphingomonas sp. . ZH0 (ZH0) is a strain screened by our laboratory. Genomic DNA of Sphingomonas ZH0 was prepared using a common bacterial genome extraction method. Supernatant, collect the bacteria; then add 100ul Solution I suspension, 30ul 10% SDS, 1ul 20mg / ml proteinase K, mix well, incubate at 37°C for 1 hour; add 100ul 15mol / L NaCl, mix well; add 20ul CTAB / NaCl Solution (CTAB 10%, NaCl 0.7mol / L), mix well, 65°C, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol 25:24:1) and mix well; centrifuge at 12000rpm, 5 minutes; take the supernatant , add 2 times the volume of absolute ethanol, 0.1 times the volume of 3mol / L NaOAC, and store at -20°C for 30 minutes; centrifuge at 12000rpm for 10 minutes; add 70% ethanol to the precipitate and wash; after the precipitate is dried, dissolve it in 20ul TE and store ...

Embodiment 2

[0043] Example 2: Amplification and TA Cloning of Alginate Lyase ZH0-I Gene

[0044] The amplification of alginate lyase ZH0-I gene and the strategy of TA cloning are as follows: figure 2 As shown, first search the full-length gene sequence of ZH0-I from GenBank (the GenBank accession number of ZH0-I gene is JX944512.1), and design a pair of specific primers, the sequence is as follows:

[0045] ZH0-1-F: GGATCCCACCCCTTCGACCAGGCCGTCGTG

[0046] ZH0-1-R: GCGGCCGCTCAGCTCGAGTGCTTTACGTGGAG

[0047] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCC characteristic sequence, forming the Not I restriction site.

[0048] Add 10ng of Sphingomonas ZH0 genomic DNA as a template to the PCR reaction mixture, and at the same time add 50ng of specific primers ZH0-I-F and ZH0-I-R, 1.8uldNTP (10mM), 2.5ul of Pfu reaction buffer and 0.15 ul of pfu (5U / ul) polymerase (Beijing Zhuangmeng International Biogene Techn...

Embodiment 3

[0049] Example 3: Prokaryotic expression vector pGEX-4T-1- ZH0-I build

[0050] pGEX-4T-1- ZH0-I A build strategy such as Image 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19- ZH0-I , separated the cleaved vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19- ZH0-I produced by cutting ZH0-I The DNA fragment (1.7kb) of the gene, and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and ZH0-I The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- ZH0-I , converting the high efficiency (10 8 ) Escherichia coli competent cells (JM109, Beijing Zhuangmeng International Biogene Technology Co., Ltd.), spread the transformed Escherichia coli on the plate of ampicillin (Amp, 100ug / ml), and cultivate overnight at 37°C , screen Amp-resistant recombinant colonies, and extract plasmids from Amp-resist...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a prokaryotic expression vector pGEX-4T-1-ZHO-I for efficiently expressing sphingomonassp.ZHO alginate lyase ZHO-I. The vector is a prokaryotic expression vector containing sphingomonassp.ZHO alginate lyase gene ZHO-I. The prokaryotic expression vector disclosed by the invention can obtain an expression product alginate lyase ZHO-I in a short time, and the obtained recombinant alginate lyase ZHO-I has wide substrate specificity; both PloyG and PloyM can be used as a substrate, and the enzyme activity can reach 53.2U/mg; the prokaryotic expression vector is a difunctional enzyme with broad application prospect; and the prokaryotic expression vector and the whole expression system disclosed by the invention are easy to operate and is favorable for the industrial production.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to a prokaryotic expression vector pGEX-4T-1- ZH0-I and its application in preparing alginate lyase ZH0-I protein. Background technique [0002] In recent years, due to the aggravation of the energy crisis and the increasingly prominent environmental problems, more and more attention has been paid to the production of bioenergy from seaweed biomass. Macroalgae are rich in carbohydrates, such as alginic acid, and the corresponding technology can be developed to convert it into bioethanol with high yield and easy pretreatment. At present, the methods of alginic acid degradation can be divided into three categories: one is the chemical degradation method, and the acid hydrolysis method is widely used at present. This method has cumbersome operation steps and severe reaction conditions. In addition, there is hydrogen peroxide oxidative degradation method; the second type i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/60C12N9/88
Inventor 伊日布斯过敏钱龙赵琳唐丽薇严金平
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap