Recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein as well as encoding gene and expressing method of fusion protein

A technology of interleukin and fusion protein, which is applied in the field of purification and inclusion body renaturation, its expression, recombinant porcine interleukin 2-Fc fusion protein and its encoding gene, which can solve the problem of unqualified product quality and reduce the ratio of recombinant protein Activity rate, precipitation and other issues

Active Publication Date: 2013-07-10
GENSUN INST OF BIOMEDICINE
View PDF3 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, most recombinant proteins expressed by E. coli are insoluble, inactive intracellular aggregates known as inclusion bodies
The renaturation of inclusion bodies is a very complicated process. If the renaturation conditions are not suitable, there will be mismatching of disulfide bonds in the molecule, and covalent or hydrophobic bonds between molecules will form aggregates. On the one hand, the specific activity of the recombinant protein will be reduced. rate, resulting in unqualified product quality, and at the same time, precipitation occurs, which affects the yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein as well as encoding gene and expressing method of fusion protein
  • Recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein as well as encoding gene and expressing method of fusion protein
  • Recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein as well as encoding gene and expressing method of fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Recombinant porcine interleukin 2-Fc fusion protein gene optimization design

[0068] 1. Codon optimization

[0069]There are 64 genetic codes, but most organisms tend to use a subset of these. Those that are most frequently used are called optimal codons, and those that are not frequently used are called rare or low-usage codons. Virtually every organism commonly used for protein expression or production (including E. coli, yeast, mammalian cells, plant cells, and insect cells) exhibits some degree of difference or bias in codon usage. The expression efficiency of genes containing optimal codons in E. coli, yeast and Drosophila was significantly higher than that of genes containing low utilization codons. Therefore, in the heterologous expression system, the codon bias largely affects the expression of recombinant proteins. Gene synthesis using preferred codons and avoiding rare codons is called codon optimization. The optimization process fully takes i...

Embodiment 2

[0096] Embodiment 2: Construction of the expression plasmid of recombinant porcine interleukin 2-Fc fusion protein gene

[0097] The fragment synthesized from the optimized recombinant porcine interleukin 2-Fc fusion protein gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing KingScript Technology Co., Ltd.) to obtain a Long-term preservation of the plasmid, recorded as pUC57-pIL2-Fc plasmid. Using the pUC57-pIL2-Fc plasmid as a template, NdeI and XhoI restriction sites were introduced upstream and downstream, respectively, for PCR amplification. The primer sequences used are as follows:

[0098] Upstream primers:

[0099] P1:GGAATTCCATATGGCTCCGACCTCGTCGTCC

[0100] Downstream primers:

[0101] P2: GCCGCTCGAGTTATTTGCCCTGGGTTTTGCTG

[0102] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymeras...

Embodiment 3

[0104] Example 3 High Expression and Identification of Recombinant Porcine Interleukin 2-Fc Fusion Protein in Escherichia coli

[0105] Specific steps are as follows:

[0106] 1. The pET21b-pIL2-Fc plasmid with correct sequencing alignment in Example 2 was transformed into a competent strain of Escherichia coli BL21 (DE3) (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight on an ampicillin plate at 37°C.

[0107] 2. Pick 1-4 recombinant colonies containing the pET21b-pIL2-Fc plasmid the next day, insert them into LB culture medium (purchased from Amresco) containing 100 μg / mL ampicillin, and culture overnight at 37°C.

[0108] 3. Take 50 μL of the overnight culture in step 2, add 5 mL of LB culture solution containing 100 μg / mL ampicillin, and culture with shaking at 37°C.

[0109] 4. Measure the OD of the bacterial solution every 1 h after inoculation 600 value, to be OD 600 When =1.0, the expression was induced with 1 mmol / L IPT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein, as well as an encoding gene and expressing, purifying and inclusion body renaturing methods of the fusion protein. The IL2 realizes a very important immunomodulatory effect in a disease generation process, but has the defects of high elimination speed in blood plasma and high industrialization cost. The invention provides the recombinant porcine IL2-Fc fusion protein by utilizing a prokaryotic expression system of escherichia coli in order to obtain a large amount of porcine IL2 with a longer half-life period, wherein a porcine IL2 part is all sequences of a porcine IL2 extracellular region, an Fc segment part comprises a hinge region, a CH2 region and a CH3 region of an antibody, and the porcine IL2 part and the Fc segment part are directly fused. The recombinant porcine IL2-Fc fusion protein provided by the invention saves most of biological activity of IL-2, greatly prolongs the half-life period and provides the guarantee for low-cost large-scale expression and the industrialization.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to a recombinant porcine interleukin 2-Fc fusion protein and its coding gene, as well as its expression, purification and inclusion body renaturation methods. Background technique [0002] Interleukin-2 (IL-2 for short) is an important cytokine produced by activated T lymphocytes, which can activate T cells, promote B cell differentiation and secrete antibodies, induce the production of interferon, and enhance The killing activity of nuclear cells and natural killer cells (NK) plays an important role in regulating the immune response of the body, and is a kind of natural immune enhancer. In the field of medical treatment, commercialized recombinant human interleukin-2 has been used in the adjuvant treatment of tumors, AIDS, hepatitis B and other diseases. In veterinary medicine, because interleukin 2 can improve the immune response of vaccines and reduce the occurrence of diseases...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21C07K1/34C07K1/14C12R1/19
Inventor马永王安良章成昌徐春林陈晨王耀方
OwnerGENSUN INST OF BIOMEDICINE