Recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein as well as encoding gene and expressing method of fusion protein
A technology of interleukin and fusion protein, which is applied in the field of purification and inclusion body renaturation, its expression, recombinant porcine interleukin 2-Fc fusion protein and its encoding gene, which can solve the problem of unqualified product quality and reduce the ratio of recombinant protein Activity rate, precipitation and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Example 1 Recombinant porcine interleukin 2-Fc fusion protein gene optimization design
[0068] 1. Codon optimization
[0069]There are 64 genetic codes, but most organisms tend to use a subset of these. Those that are most frequently used are called optimal codons, and those that are not frequently used are called rare or low-usage codons. Virtually every organism commonly used for protein expression or production (including E. coli, yeast, mammalian cells, plant cells, and insect cells) exhibits some degree of difference or bias in codon usage. The expression efficiency of genes containing optimal codons in E. coli, yeast and Drosophila was significantly higher than that of genes containing low utilization codons. Therefore, in the heterologous expression system, the codon bias largely affects the expression of recombinant proteins. Gene synthesis using preferred codons and avoiding rare codons is called codon optimization. The optimization process fully takes i...
Embodiment 2
[0096] Embodiment 2: Construction of the expression plasmid of recombinant porcine interleukin 2-Fc fusion protein gene
[0097] The fragment synthesized from the optimized recombinant porcine interleukin 2-Fc fusion protein gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing KingScript Technology Co., Ltd.) to obtain a Long-term preservation of the plasmid, recorded as pUC57-pIL2-Fc plasmid. Using the pUC57-pIL2-Fc plasmid as a template, NdeI and XhoI restriction sites were introduced upstream and downstream, respectively, for PCR amplification. The primer sequences used are as follows:
[0098] Upstream primers:
[0099] P1:GGAATTCCATATGGCTCCGACCTCGTCGTCC
[0100] Downstream primers:
[0101] P2: GCCGCTCGAGTTATTTGCCCTGGGTTTTGCTG
[0102] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymeras...
Embodiment 3
[0104] Example 3 High Expression and Identification of Recombinant Porcine Interleukin 2-Fc Fusion Protein in Escherichia coli
[0105] Specific steps are as follows:
[0106] 1. The pET21b-pIL2-Fc plasmid with correct sequencing alignment in Example 2 was transformed into a competent strain of Escherichia coli BL21 (DE3) (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight on an ampicillin plate at 37°C.
[0107] 2. Pick 1-4 recombinant colonies containing the pET21b-pIL2-Fc plasmid the next day, insert them into LB culture medium (purchased from Amresco) containing 100 μg / mL ampicillin, and culture overnight at 37°C.
[0108] 3. Take 50 μL of the overnight culture in step 2, add 5 mL of LB culture solution containing 100 μg / mL ampicillin, and culture with shaking at 37°C.
[0109] 4. Measure the OD of the bacterial solution every 1 h after inoculation 600 value, to be OD 600 When =1.0, the expression was induced with 1 mmol / L IPT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 