A method for preparing Escherichia coli that automatically degrades nucleic acid during lysis

A technology of automatic degradation of Escherichia coli, applied in the biological field, can solve the problems of high viscosity of lysate affecting purification, achieve the effect of reducing cytotoxicity, reducing the accumulation of acetic acid, and simplifying the purification steps

Active Publication Date: 2016-03-23
徐东
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the embodiments of the present invention is to provide a method for preparing Escherichia coli that automatically degrades nucleic acid during lysis, aiming to solve the problem in the prior art that the viscosity of the lysate is too high to affect purification when Escherichia coli is used to express recombinant proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preparing Escherichia coli that automatically degrades nucleic acid during lysis
  • A method for preparing Escherichia coli that automatically degrades nucleic acid during lysis
  • A method for preparing Escherichia coli that automatically degrades nucleic acid during lysis

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0019] The embodiment of the present invention provides a method for preparing Escherichia coli that automatically degrades nucleic acid during lysis, comprising the following steps:

[0020] S01 connects the pelB signal peptide coding sequence with the Staphylococcus aureus nuclease gene sequence to obtain the first combination sequence, wherein the pelB signal peptide coding sequence is upstream of the Staphylococcus aureus nuclease gene sequence, and then the first combination The sequence is connected with the kanamycin resistance gene sequence to obtain a second combination sequence, wherein the first combination sequence is upstream of the kanamycin resistance gene sequence;

[0021] S02 replace the ptsG gene sequence of Escherichia coli JM109 with the second combined sequence prepared in step S01, to obtain Escherichia coli JM109 with ptsG gene deletion;

[0022] S03 Knockout the kanamycin resistance gene in the second combined sequence in Escherichia coli JM109 in whic...

Embodiment 1

[0055] 1. Obtaining SNase fragments

[0056] Synthesize forward and reverse primers according to the following sequence:

[0057] Forward primer P1: GGG GGATCC ATGAAGTCAAATAAATCGCTSEQ ID NO:3

[0058] Reverse primer P2: GGG CTCGAG TTATTTACTCCAAATATTTA SEQ ID NO: 4

[0059] Add the BamHI restriction site to the P1 primer, which is the underlined part, add the XhoI restriction site to the P2 primer, which is the underlined part, use P1 and P2 as primers, and use the Staphylococcus aureus genome as a template to prepare a 50 μL PCR reaction system, as follows:

[0060]

[0061] PCR reaction conditions:

[0062] Denaturation at 94°C for 5 minutes,

[0063] 94°C for 30s, 56°C for 1min, 72°C for 40s, 30 cycles,

[0064] Extend at 72°C for 10 min.

[0065] After the reaction, it was detected by electrophoresis on a 1% agarose gel containing 20 μg / mL ethidium bromide (EB). The length of the obtained target fragment was 552bp, which was verified by sequencing after PCR clon...

Embodiment 2

[0126] Steps 1-6 are the same as in Example 1.

[0127] 7. Transformation of pKD46 into Escherichia coli JM109 competent cells

[0128] Preparation of Escherichia coli JM109 competent cells.

[0129] The plasmid pKD46 was transformed into the Escherichia coli JM109 competent cells by heat shock method. Then pick a single clonal colony and culture overnight at 30°C with shaking in LB medium containing ampicillin (final concentration 34 μg / mL), then add 1 mL of the bacterial solution to 50 mL of LB medium with the same concentration of ampicillin, shake at 30°C Cultivate, to A 600 When it is 0.2-0.4, add L-arabinose (final concentration is 10mM), continue shaking culture, until A 600 centrifuge at 4000g for 10 minutes at 4°C, discard the supernatant, collect the bacteria, wash three times with deionized water, and finally resuspend the bacteria in 150 μL of pre-cooled 10% glycerol, and take 50 μL for electrotransformation.

[0130] 8. Electrotransformation of the target gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention is applicable to the field of biotechnology, and provides a preparation method of an Escherichia coli capable of automatically degrading nucleic acids during cracking. The method comprises steps of: connecting a pelB signal peptide sequence with an SNase sequence to obtain a first combined sequence; connecting the first sequence with a Km gene sequence to obtain a second combined sequence; substituting a ptsG gene of Escherichia coli with the second combined sequence to obtain Escherichia coli with deletion of ptsG gene; and knocking out the Km gene from the second sequence and in the Escherichia coli with deletion of ptsG gene. The preparation method of Escherichia coli provided by the invention has the advantages of high efficiency of homologous recombination; the SNase expressed by the prepared Escherichia coli can secret into a periplasmic space, and a product expressed by the SNase gene does not influence the expression of other protein; and the method can reduce the accumulation of acetic acid in a fermentation process and promote thallus growth.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing Escherichia coli which automatically degrades nucleic acid during lysis. Background technique [0002] In the process of large-scale intracellular expression of recombinant proteins using Escherichia coli as the host bacteria, before purifying the target recombinant protein, the bacteria need to be broken to release the target protein. The viscosity of the liquid increased significantly, which brought difficulties to the subsequent purification work. The FDA has strict requirements on the limit of nucleic acid contamination of pharmaceutical recombinant proteins (each dose should be less than 100pg), so it is also very necessary to remove nucleic acid contamination. [0003] The enzyme that hydrolyzes phosphodiester bonds non-specifically is phosphodiesterase (phosphodiesterase), and the phosphodiesterase that specifically hydrolyzes nucleic acid i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C12N1/21C12R1/19C12R1/445
Inventor 徐东任昌义
Owner 徐东
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap