Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant drought resistance related protein as well as encoding gene and application thereof

A technology that encodes genes and drought tolerance, applied in the field of plant genetic engineering, can solve problems such as the decline of photosynthetic rate, and achieve the effects of enhancing drought tolerance, improving plant yield and drought tolerance, and improving drought tolerance

Active Publication Date: 2013-09-18
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The reverse cDNA of potato cyFBPase was transferred into potato under the regulation of 35S promoter, when the enzyme activity was 20% lower than that of wild type, 3-phosphoglycerate, triose phosphate and fructose-1 were accumulated in the source leaves, 6-diphosphate; in light source and CO 2 Photosynthetic rate drops significantly under sufficient conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant drought resistance related protein as well as encoding gene and application thereof
  • Plant drought resistance related protein as well as encoding gene and application thereof
  • Plant drought resistance related protein as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1, the acquisition of rapeseed cy-fbpase gene fragment

[0051] Proceed as follows:

[0052] (1) Cloning of the cy-fbpase gene: Firstly, by comparing the known homologous sequences of the cy-fbpase gene, the conserved sequence of the gene was found, and primers were designed. Conserved sequence amplification primers are as follows:

[0053] F-1 GTTGTTTTTGATCCACTTGATGG (Seq ID No: 5)

[0054] R-1 GGCTTGCTCCATCAAGAACG (Seq ID No: 6)

[0055] Rapeseed genomic DNA was used as a template, and F-1 and R-1 were used as primers (primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.) for PCR amplification. The reaction system was as follows: 10×Taq DNA polymerase buffer 5 μL, dNTP Mix (10mM) 2 μL, F-1 (10 μM) 1 μL, R-1 (10 μM) 1 μL, rapeseed genomic DNA (50 ng / μL) 1 μL, Taq DNA polymerase (Taq DNA polymerase was purchased from TaKaRa Company, the same below) 0.5 μL , ddH 2 O 39.5 μL, a total of 50 μL. PCR reaction conditions: 94°C for 5min; 94°C f...

Embodiment 2

[0062] The construction of embodiment 2, cy-fbpase gene expression vector

[0063] Proceed as follows:

[0064] (1) In order to prevent the restriction site contained in the target gene from being cut during the vector construction process, the cDNA sequence of the rapeseed cy-fbpase gene was analyzed by the software Vector NT1, and the 173bp site of the rapeseed cy-fbpase gene was From G to A, from G to G at the 258th position, and from A to G at the 374th position, although the codon changes, the amino acid encoded by it does not change. The product was subjected to site-directed mutagenesis by stacking extension PCR method, and the sequence obtained after site-directed mutagenesis is shown in SEQ ID No: 4 (the gene is still referred to as: cy-fbpase hereinafter).

[0065] (2) Construction of the intermediate vector: PstI and XhoI (restriction enzymes were purchased from Fermentas, the same below) were used to simultaneously digest the vector plasmid pG4AB and both ends of ...

Embodiment 3

[0067] Embodiment 3, transformation of cy-fbpase gene

[0068] Proceed as follows:

[0069] The constructed expression vector pGBI-cy-fbpase was transformed into Agrobacterium by electric shock method

[0070] (1) Take out the prepared LBA4404 competent cells in the -80°C refrigerator, add 1 μL of the plant overexpression vector pGBI-cy-fbpase constructed in Example 2 to 50 μL of competent cells, mix well, and ice-bath for 15 minutes .

[0071] (2) Inhale into the 2mm electric shock cup (to avoid the generation of air bubbles), 2500V electric shock conversion.

[0072] (3) Immediately after the electric shock, add 800 μl of LB liquid medium to the electric shock cup; mix it with a pipette tip several times, then suck it out and add it to the EP tube until the bacterial solution is completely sucked out, and then culture and recover at 28°C and 180rpm for 4-5 hours.

[0073] (4) Spread the bacteria on an LB plate containing 50 μg / mL rifampicin (abbreviated as: Rif) and kanam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant drought resistance related protein, belonging to the field of plant gene engineering. The plant drought resistance related protein disclosed by the invention is composed of an amino acid sequence as shown by SEQ ID No: 1 and a derivative sequence thereof. The invention further discloses a gene of the protein, wherein the gene is composed of a nucleotide sequence as shown by SEQ ID No: 2 and a derivative sequence thereof. The invention further discloses usage of the gene for improving the plant drought resistance. The plant drought resistance related protein disclosed by the invention greatly increases the sucrose content of transgenic plants by over-expression of cy-FBPase and greatly improves the drought tolerance of the transgenic plants. The plant drought resistance related protein disclosed by the invention provides an effective way of improving the plant drought tolerance through genetic engineering.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a protein related to plant drought tolerance, a gene encoding the protein, and an application of the gene in improving plant yield and drought tolerance. Background technique [0002] There are two types of fructose-1,6-bisphosphatase in plant cells, chloroplast fructose-1,6-bisphosphatase (referred to as: cp-FBPase) and cytoplasmic fructose-1,6-bisphosphatase (abbreviated as: cy-FBPase), the two enzymes have similar structures and the same substrate, both of which catalyze the hydrolysis of fructose-1,6-bisphosphatase into fructose-6-phosphate and inorganic phosphate. However, the two enzymes have different action positions, enzyme activity regulation methods and action pathways are also different. Among them, cp-FBPase participates in the Calvin cycle and is an enzyme regulated by light; while the activity of cy-FBPase is not regulated by light. The cy-FBPa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/16C12N15/55C12N15/63C12N5/10A01H5/00C12N15/11C12Q1/68
Inventor 张锐郭三堆郭利娜
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com