Plant drought resistance related protein as well as encoding gene and application thereof
A technology that encodes genes and drought tolerance, applied in the field of plant genetic engineering, can solve problems such as the decline of photosynthetic rate, and achieve the effects of enhancing drought tolerance, improving plant yield and drought tolerance, and improving drought tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1, the acquisition of rapeseed cy-fbpase gene fragment
[0051] Proceed as follows:
[0052] (1) Cloning of the cy-fbpase gene: Firstly, by comparing the known homologous sequences of the cy-fbpase gene, the conserved sequence of the gene was found, and primers were designed. Conserved sequence amplification primers are as follows:
[0053] F-1 GTTGTTTTTGATCCACTTGATGG (Seq ID No: 5)
[0054] R-1 GGCTTGCTCCATCAAGAACG (Seq ID No: 6)
[0055] Rapeseed genomic DNA was used as a template, and F-1 and R-1 were used as primers (primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.) for PCR amplification. The reaction system was as follows: 10×Taq DNA polymerase buffer 5 μL, dNTP Mix (10mM) 2 μL, F-1 (10 μM) 1 μL, R-1 (10 μM) 1 μL, rapeseed genomic DNA (50 ng / μL) 1 μL, Taq DNA polymerase (Taq DNA polymerase was purchased from TaKaRa Company, the same below) 0.5 μL , ddH 2 O 39.5 μL, a total of 50 μL. PCR reaction conditions: 94°C for 5min; 94°C f...
Embodiment 2
[0062] The construction of embodiment 2, cy-fbpase gene expression vector
[0063] Proceed as follows:
[0064] (1) In order to prevent the restriction site contained in the target gene from being cut during the vector construction process, the cDNA sequence of the rapeseed cy-fbpase gene was analyzed by the software Vector NT1, and the 173bp site of the rapeseed cy-fbpase gene was From G to A, from G to G at the 258th position, and from A to G at the 374th position, although the codon changes, the amino acid encoded by it does not change. The product was subjected to site-directed mutagenesis by stacking extension PCR method, and the sequence obtained after site-directed mutagenesis is shown in SEQ ID No: 4 (the gene is still referred to as: cy-fbpase hereinafter).
[0065] (2) Construction of the intermediate vector: PstI and XhoI (restriction enzymes were purchased from Fermentas, the same below) were used to simultaneously digest the vector plasmid pG4AB and both ends of ...
Embodiment 3
[0067] Embodiment 3, transformation of cy-fbpase gene
[0068] Proceed as follows:
[0069] The constructed expression vector pGBI-cy-fbpase was transformed into Agrobacterium by electric shock method
[0070] (1) Take out the prepared LBA4404 competent cells in the -80°C refrigerator, add 1 μL of the plant overexpression vector pGBI-cy-fbpase constructed in Example 2 to 50 μL of competent cells, mix well, and ice-bath for 15 minutes .
[0071] (2) Inhale into the 2mm electric shock cup (to avoid the generation of air bubbles), 2500V electric shock conversion.
[0072] (3) Immediately after the electric shock, add 800 μl of LB liquid medium to the electric shock cup; mix it with a pipette tip several times, then suck it out and add it to the EP tube until the bacterial solution is completely sucked out, and then culture and recover at 28°C and 180rpm for 4-5 hours.
[0073] (4) Spread the bacteria on an LB plate containing 50 μg / mL rifampicin (abbreviated as: Rif) and kanam...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 