Anti-rabies-virus combination molecule 2E1
A technology that combines molecules and rabies virus, applied in the fields of biotechnology and immunology, and can solve problems such as limited application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0093] Embodiment 1, the acquisition of peripheral blood mononuclear cells (PBMC)
[0094] Peripheral blood was drawn from volunteers who had been injected with rabies virus vaccine, and conventional Ficoll-Paque (manufacturer: (CEDARLANE) company) density gradient centrifugation, to obtain 10 7 Above peripheral blood mononuclear cells (PBMC).
[0095] Ficoll separation method:
[0096] (1) Collect 10ml of whole blood in a 50ml centrifuge tube (pre-containing 1ml of 4% (w / v) sodium citrate), invert and mix 8-10 times (the final concentration of sodium citrate is 0.4%);
[0097] (2) Add an equal volume of RPMI 1640 (containing sodium citrate), and mix well;
[0098] (3) Use a 15ml transparent centrifuge tube to spread 3ml of lymphocyte separation medium, and carefully add 6ml of blood sample on it. Form the separation interface (or 4ml separation solution plus 8ml blood sample) Tube B: 500μl Opti-MEM+20μl Lipofectamine Reagent;
[0099] (4) Centrifuge at room temperature ...
Embodiment 2
[0103] Example 2, G protein-specific memory B cell sorting
[0104] Using FITC-CD19 / APC-IgG / Cy3-RV-G as a marker, the specific B cells were obtained by flow cytometry to a 96-well RT-PCR plate, with one cell per well to obtain G protein-specific memory B cells.
[0105] 1) Rabies virus envelope protein G protein (RV-G) (G protein of Rabies virus strain SRV9, GenBank: AF499686.2, position 3317-4894 in the complete genome sequence) was expressed by mammalian cell CHO expression system (purchase From Invitrogen Company, prepared according to the experimental instructions);
[0106] 2) Protein G was labeled with biotin: No-Weigh Sulfo-NHS-LC-Biotin (purchased from PIERCE) 10 mM reagent; the other two markers FITC-CD19A and APC-IgG were purchased from BD Bioscience;
[0107] 3) Labeling of sorted cells: PBMC cells were divided into groups, experimental group + control group, markers were added according to the number of cells, stained in the dark, and labeled, resuspended in PBS, ...
Embodiment 3
[0110] Embodiment 3, antibody gene
[0111] For the antibody secreted by B cell 2E1, the experiment was carried out according to the method reported in the literature (Journal of Immunological Methods 329 (2008) 112-124), that is, the antibody heavy and light chain variable region genes were obtained by RT and Nested-PCR methods, with a molecular weight of about 400bp , β-actin as an internal reference (343bp), the electrophoretic patterns of β-actin, heavy chain gene and light chain gene are shown in figure 2 , image 3 with Figure 4 . The variable region of the heavy and light chain gene of the antibody derived from the same B cell was connected to the pGEMT vector (purchased from Invitrogen), and the antibody gene was sequenced and verified. The obtained 2E1 fully human antibody gene sequence is as follows:
[0112] 2E1 heavy chain variable region gene sequence (SEQ ID NO: 1) (5'→3'):
[0113] CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGA AGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More