Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of corn Lc gene as selection marker in cotton transgenosis breeding

A screening marker, transgenic technology, applied in the application, genetic engineering, plant genetic improvement and other directions, to achieve the effect of improving work efficiency, ensuring expression, and saving detection costs

Inactive Publication Date: 2013-11-13
COTTON RES INST SHANXI ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Whether it can be used as a transgenic screening marker gene in cotton has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of corn Lc gene as selection marker in cotton transgenosis breeding
  • Application of corn Lc gene as selection marker in cotton transgenosis breeding
  • Application of corn Lc gene as selection marker in cotton transgenosis breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Construction of vector

[0027] 1.1 Lc Gene cloning

[0028] The total RNA of purple leaf sheath maize was extracted, and the full length of maize cDNA was obtained by reverse transcription. Using it as a template, primers were designed according to Genebank M26227

[0029] Lc-L(BamHI): GGGGGATCCATGGCGCTTTCAGCTTCCCG

[0030] Lc-R(SalI): GCGTCGACTCACCGCTTCCCTATAGCTTTGC

[0031] The 1.8kb PCR product was recovered, BamHI and SalI were double digested and then ligated to p EASY-T vector and sent for sequencing. The result was completely consistent with the Genbank M26227 sequence alignment. Get p EASY-T- Lc .

[0032] 2.1 Vector pBI121- Lc Build

[0033] Add SalI restriction site between NOS of GUS gene and SacI restriction site in pBI121 plasmid:

[0034] Design primers

[0035] Nos (SalI)L1: 5'-GTCGAC(SalI)GAATTTCCCCGATCGTTCAAACAT-3';

[0036] Nos R1: 5'-ATAGATGACACCGCGCGCGATAATTTATCCT-3';

[0037] Nos (SacI-SalI) L2: 5'-GCGAGCTC(SacI)GTCGAC(SalI)GAATTTCCCCGATCGTTC-3...

Embodiment 2

[0042] Example 2 Turn Lc Validation test of genetic cotton

[0043] Transform cotton with conventional Agrobacterium-mediated method. For verification Lc Genes can be used as selection marker genes. A set of experiments was designed and carried out. The hypocotyls of cotton after soaking and co-cultivation were divided into two mediums, one containing antibiotic selection agent; the other was not Callus induction medium containing antibiotic selection agent. At the same time, cultivate a group of uninfected materials as a control. repeat three times. During the cultivation process, it was found that the callus induced by the infiltrated material appeared red, see figure 2 (Reference materials for substantive examination figure 2 ), and the uninfected callus as a control did not see red, see image 3 (Reference materials for substantive examination image 3 ), so when picking callus on a medium that does not contain antibiotics, pick the red callus as soon as possible, an...

Embodiment 3

[0044] Example 3 Turn Lc Phenotype observation and molecular detection of genetic cotton

[0045] 3.1 Observation of in vitro culture

[0046] Differentiate the cell mass into embryos and transfer Lc Somatic embryos of genetic cotton and somatic embryos of untransformed cotton Figure 4 To Figure 5 (Reference materials for substantive examination Figure 4 , 5 ), until young seedlings have red and purple, you can still pick materials based on color, and eliminate yellow-green materials that do not see red and purple.

[0047] The results of a comparative test with or without antibiotic screening found that the materials that have been screened by color change without antibiotics are finally positive after PCR verification; while 10% of the materials screened by NPTII only contain NPTII Gene without detection Lc Genes, these materials also have no color change as the control.

[0048] Take a leaflet of the seedling, extract DNA for PCR detection (such as Image 6 ), it was found that...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant genetic engineering, and in particular relates to an application of a corn Lc gene as a selection marker in cotton transgenosis breeding. According to the invention, the corn Lc genes are integrated in cotton genomes, and transgenosis cotton plants are locally red, fully red, locally purple or fully purple in the seedling stage or growing stage and is obviously different from a contrast. In the whole culturing process, light adjustment is a key factor for callus growth and development, differentiation and germination of embryo and fertility of matured plants. The transgenosis regenerated cotton plant phenotype observation result is remarkably consistent with a molecular detection result, which shows that the corn Lc gene can completely replace antibiotic to be used as a selection marker for cotton transgenosis, and lays a foundation for cotton transgenosis breeding of antibiotic-free genes.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, in particular to a corn Lc Application of genes as selection markers in transgenic breeding of cotton. Background technique [0002] In plant genetic engineering, the selection of screening marker genes plays a crucial role. Selectable marker genes have been applied for a long time. Selectable markers are special resistance to selective substances, so that transformed cells can continue to survive and grow on selective media, while untransformed cells are inhibited by selective substances in the medium or The kill, efficacy of this screening separation and the final transformation efficiency depend on the selection of the selection marker gene. [0003] The screening marker genes widely used in plant transgenics mainly include antibiotic genes and herbicide resistance genes. Antibiotic screening agents commonly used in cotton transgenics include kanamycin and hygromycin; herbicide scr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29A01H5/00
Inventor 范小平王玉香范博红马理军
Owner COTTON RES INST SHANXI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com