GhLac1 gene of broad-spectrum resistance of mediated cotton and application thereof

A cotton, broad-spectrum technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as unsatisfactory effect, high biological control cost, and large environmental impact.

Active Publication Date: 2013-12-04
HUAZHONG AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cotton verticillium wilt is a soil-borne vascular disease caused by Verticillium dahliae. At present, there is no specific and specific chemical agent, and the cost of biological control is high, and the effect is not ideal. Therefore, breeding of disease-resistant varieties It is the main way to control the disease (Wang Shengzheng et al., Study on genetic characteristics of cotton KV-3 resistance in new lines resistant to Verticillium wilt. Acta Cotton Sinica, 2010, 22(5): 501-504)
Studies have shown that the resistance of upland cotton to Verticillium wilt is basically susceptible or resistant, and most of the disease-resistant loci carried by it are micro-effect polygenic loci, which are greatly affected by the environment and difficult to aggregate. No varieties with high resistance to Verticillium wilt of cotton have been widely applied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GhLac1 gene of broad-spectrum resistance of mediated cotton and application thereof
  • GhLac1 gene of broad-spectrum resistance of mediated cotton and application thereof
  • GhLac1 gene of broad-spectrum resistance of mediated cotton and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Isolation and Cloning of GhLac1 Gene

[0044] 1. Expression Analysis

[0045] The applicant's previous work was to rebuild the SSH (Suppression subtractive hybridization) library from the cotton protoplast cell wall (see literature: Yang et al., Expression profile analysis of genes involved in cell wall regeneration during protoplast culture in cotton by suppression subtractive hybridization and macroarray.2008, 59.3661-3674) to screen and analyze the genes involved in cell wall remodeling, and through the analysis, it was found that there were differences in the expression of a gene at different time points of cell wall remodeling. Identification by RT-PCR demonstrated this distinct expression pattern of the gene (see figure 1 ) Total RNA was extracted from upland cotton line 'YZ-1' at different time points for cell wall reconstruction (extraction method was based on Zhu et al., An improved simple protocol for isolation of high quality RNA from Gossypium spp. suitable...

Embodiment 2

[0051] Construction and transformation of overexpression vector

[0052] In order to verify the function of the GhLac1 gene, the applicant constructed an overexpression vector to transform cotton hypocotyls.

[0053] According to the GhLac1ORF obtained in Example 1, the overexpression primers were designed, and the recombination exchange sites of attB1 and attB2 were added to the two ends of the primers respectively, and the primers were named as GhLac1oe-F (5'

[0054] GGGGACAAGTTTGTACAAAAAAGGCAGGCTTATGGGTTTACAGCAAGGTTTAGTGA3') and GhLac1oe-R (5'GGGGACCACTTTGTACAAGAAAGCTGGGT CTAGGTTCCAGGACAACGAGGCAT3'), and then PCR amplification was carried out using the cDNA of the GhLac1 gene as a template, and the obtained PCR product was constructed into the vector pK2GW7,0 by BP and LR recombination reactions (purchased from Belgian National Ghent University), 2 μl of the recombinant reaction product was electrotransformed into Escherichia coli (E. Coli) competent cell Top10 (purchased ...

Embodiment 3

[0117] pK2GW7, 0-GhLac1 embryogenic callus cell wall remodeling

[0118] According to the method reported by Yang et al. (Yang et al., 2007, Production and characterization of asymmetric hybrids between upland cotton Coker201(Gossypium hirsutum) and wild cotton(G.klozschianum Anderss).Plant Cell, Tissue and Organ Culture89, 225-235) , isolate the protoplasts of GhLac1 and YZ-1 embryogenic callus, the specific process is as follows:

[0119] 1. Take about 0.1 g of GhLac1 and YZ-1 embryogenic calli, suspend them in the enzyme solution sterilized by filtration, shake gently (40 r / min) at 28±1° C. for 16-20 h to separate protoplasts. The composition of the enzyme liquid is as follows: 1.5% (w / v) Cellulase Onozuka R-10, 1% (w / v) Macerozyme R-10 and 2% (w / v) Hemicellulase dissolved in protoplasts Lotion CPW9M.

[0120] CPW9M formula:

[0121]

[0122] 2. The enzymatically hydrolyzed protoplasts were filtered through a double-layer stainless steel mesh with a pore size of 100 a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant gene engineering, and particularly relates to GhLac1 gene of broad-spectrum resistance of mediated cotton. According to the invention, the nucleotide sequence of the GhLac1 gene is as shown by SEQ ID NO:1, the sequence of amino acid of coded protein thereof is as shown by SEQ ID NO:2, and an open reading frame thereof is the sequence corresponding to 20-1720th basic group shown by the SEQ ID NO:1. The invention also discloses an application of the gene in cotton heredity and transformation. Through excessive expression of the gene, the synthesis of lignose in the plant can be promoted, so as to accelerate lignification process, and meanwhile, to accelerate reconstruction of cell walls of damaged cells. The cloned gene provided by the invention can be applied to the select breeding of broad-spectrum disease resistance or insect-resistant novel varieties through heredity and transformation.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a cotton laccase gene (GhLac1) and its coding gene and application. The present invention adopts the method of reverse genetics, through the screening and analysis of differentially expressed genes in the SSH (Suppression subtractive hybridization) library of cotton protoplast cell wall reconstruction, the isolated and cloned GhLac1 gene is a gene with broad-spectrum resistance, overexpressed The gene can enhance the resistance of cotton to cotton bollworm (Helicoverpa armigera Hubner), cotton aphid (Aphis gossypii Glover), Verticillium dahliae and gray mold (Botrytis cinerea) and other diseases and insect pests. The present invention also relates to a vector containing the gene or its homologous gene and the application of the gene or its functional analog to enhance broad-spectrum resistance of plants in agricultural production. Background techniqu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/82A01H5/00
Inventor张献龙朱龙付闽玲胡琴
OwnerHUAZHONG AGRI UNIV