Lily ester floral gene LoAAT1 and application thereof

A lily ester and gene technology, applied in the field of genetic engineering, can solve the problem of not detecting the activity of alcohol acyltransferase and the like

Active Publication Date: 2013-12-11
SOUTH CHINA AGRI UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Transformed yeast found that CM-AAT1 had the ability to synthesize volatile components of esters, while CM-AAT2 did not detect alcohol acyltransferase activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lily ester floral gene LoAAT1 and application thereof
  • Lily ester floral gene LoAAT1 and application thereof
  • Lily ester floral gene LoAAT1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 LoAAT1 Acquisition of gene cDNA and full-length DNA:

[0037] S1. Extraction of lily petal RNA: Weigh 0.2 g of lily petals in full bloom, add liquid nitrogen and quickly grind them into powder, and quickly transfer to 0.5 mL 2 % CTAB (containing 0.1% mercaptoethanol) extract stored at 4 °C. In a 2 mL centrifuge tube, shake until thoroughly mixed; place at room temperature for 5 minutes, lay the centrifuge tube flat to maximize the surface area; centrifuge at 12,000 rpm at 4°C for 1 min, and transfer the supernatant to a new RNase-free centrifuge tube. Add 0.1mL 5M NaCl, mix gently; add 0.3mL chloroform, mix upside down; centrifuge at 12000rpm at 4°C for 10min, transfer the upper aqueous phase to a new RNase-free centrifuge tube. Add pre-cooled isopropanol equal to the volume of the obtained water, invert and mix well, place at room temperature for 10 minutes, place the centrifuge tube horizontally to maximize the surface area; centrifuge at 12000 rpm at 4°C f...

Embodiment 2

[0045] Example 2 LoAAT1 Gene expression analysis:

[0046] Trizol method (TaKaRa) was used for RNA extraction of lily petals of different varieties, petals of different developmental stages of Siberia lily and different tissue parts of Siberia lily, and SYBR green (TaRaKa) method for fluorescence quantitative PCR. The specific principle of dye method is shown in the instruction manual. Using Primer Premier 5.0 software to design real-time fluorescent quantitative PCR primers, according to the principles of fluorescent quantitative PCR primer design, use Primer premier 5.0 to design primers respectively, and detect whether there are mismatches or primer dimers and their amplification efficiency by fluorescent quantitative PCR. Select a pair of optimal primers, P1: ATTGTGGTGCCAGTTTGCTTGC; as shown in SEQ ID NO:12. P2: CCCTTTTACCCTTCGTTGAACTTC; shown in SEQ ID NO:13. The internal reference gene ACT was designed with Primer premier 5.0 according to the design principles of R...

Embodiment 3

[0049] Example 3 Hctps1 Gene prokaryotic expression:

[0050] S1. According to the obtained LoAAT1 The full-length cDNA of the gene, containing Bam HI and not Ⅰ PCR amplification with specific primers for restriction sites. The PCR product was recovered with the Takara recovery kit, and the recovered product was directly used Bam HI and N otI restriction endonuclease for double digestion, 1% agarose gel to recover the target fragment. For pET-28a prokaryotic expression vector Bam HI and N otI restriction enzyme was used for double digestion and 1% agarose gel was used to recover large fragments. After ligation overnight at 16°C, the ligation product was transformed into Escherichia coli ( E. coli ) DH5α competent cells; the recombinant prokaryotic expression vector was obtained after the extracted plasmid was identified by enzyme digestion and sequencing.

[0051] S2. Transform Escherichia coli (Rosetta) competent cells with the identified recombinant plasmid D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention belongs to the technical field of gene engineering, and in particular discloses a lily ester floral gene LoAAT1 and application thereof. A nucleotide sequence of the LoAAT1 gene is shown in SEQ ID NO: 1-2, and an amino acid sequence of protein coded by the gene is shown in SEQ ID NO: 3. The LoAAT1 gene is expressed in lily tissue with fragrance and is not expressed in lily varieties having no fragrance, and the expression s related to a development process of flower. The LoAAT1 gene can be linked to any one plant transformation vector and introduced into cells of lily or other plants, to obtain transgenic fragrance expressing the gene, thus being used for production; in addition, a molecular marker can be generated depending on the gene sequence information, and the molecular marker is used for identifying fragrance genotype of lily or other plants and for marker-assisted selective breeding, thus enhancing selecting efficiency of breeding.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a lily ester floral fragrance gene LoAAT1 and its application. Background technique [0002] The floral fragrance of most plants is formed by a series of low-molecular-weight volatiles mixed together, and its chemical components are mainly terpenes, phenylpropionic acid compounds / benzene ring compounds and fatty acid derivatives (Pichersky et al , 2006; Dudareva et al , 2004). Ethyl benzoate, a phenylpropane ester component formed through the shikimic acid pathway, is one of the main characteristic aroma components of lily (Fan Yanping, 2008). [0003] Ethyl benzoate is a phenylpropionic acid compound / benzene ring compound, which is a precursor of L-phenylalanine. In plastids, phenylalanine is produced through the shikimate pathway, and cinnamic acid is catalyzed by phenylalanine lyase (PAL). Cinnamic acid is catalyzed by a series of enzymes to synthesize benza...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/63C12N1/15C12N1/19C12N1/21A01H5/00C12Q1/68A61K38/16
Inventor 范燕萍刘芳尹君乐余让才王文君李满意黄丽君岳跃冲玉云祎
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap