Rapid test method for reverse transcription loop-mediated isothermal amplification of turnip mosaic viruses
A turnip mosaic virus, ring-mediated isothermal technology, applied in the field of biotechnology virus detection, can solve the problems of restricting the use and promotion of rapid diagnostic methods, cumbersome and complicated operating procedures, and specific limitations of detection, and achieve easy promotion and use , Improve detection efficiency and reduce detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Establishment of a reverse transcription loop-mediated isothermal amplification detection method for turnip mosaic virus
[0043] The radish samples infected with turnip mosaic virus were used as the detection object, and the healthy radish samples were used as the negative control.
[0044] 1. Primer design:
[0045] According to the nucleic acid sequence of turnip mosaic virus reported on NCBI, 8 sets of specific primers were designed by using the LAMP primer design software PrimerExplorer V4, and 4 sets of primers were preliminarily screened out according to the principles of LAMP primer design. The primer sequences are as follows (5'-3') :
[0046] First set of primers:
[0047] F3: TGCCACGATATGGTCTTC; as shown in SEQ ID NO.1;
[0048] B3: TGTTTCTCTACCGTTGTACC; as shown in SEQ ID NO.2;
[0049] FIP: CACGTATTGGAGTTCTAGAAGTCAT-AGCGCAATTTAACCGACA; as shown in SEQ ID NO.3;
[0050] BIP: CGAGAGAGGCACACATCCAG-AACGTTTCCATCCAAGCC, as shown in SEQ ID NO.4.
...
Embodiment 2
[0077] Embodiment 2: Optimization of RT-LAMP detection system
[0078] The optimal primers can be screened out by Example 1 to be the first group of primers, but the nucleic acid electrophoresis bands of the first group of primers are not very obvious, so by the two factors Mg of the main influence on the construction system 2+ Concentration and internal and external primer concentration ratio screening to determine the optimal detection system. Reaction system (25μL):
[0079] A: 10× Thermopolbuffer 2.5μL (20mM Tris-HCl, 10mMKCl, 2MmMgSO 4 , 10mM (NH 4 ) 2 SO 4 , 0.1%TritonX-100), primers (F3 and B3) in the first set of primers (F3 and B3) 0.2μM, primers in the first set of primers (FIP and BIP) 1.0μM, dNTPs 1.0mM, MgCl 2 4mM, 200U / μLM M-MLV 1.0μL, BstDNApolymerase (NEB) 1.5μL, template RNA 2.0μL;
[0080] B: 10× Thermopolbuffer 2.5μL (20mM Tris-HCl, 10mMKCl, 2MmMgSO 4 , 10mM (NH 4 ) 2 SO 4 , 0.1%TritonX-100), primers (F3 and B3) in the first set of primers (F3 and ...
Embodiment 3
[0084]Embodiment 3: Specificity and stability of RT-LAMP detection method in the present invention
[0085] According to the reaction system A and the reaction conditions of the above-mentioned Example 2, the healthy plants in the field, TuMV, BBWV, CMV, TMV, and TRV susceptible samples were tested at the same time, and the specificity and stability of the RT-LAMP method were tested. Use RNA extracted from healthy plants, leaves infected with TuMV, BBWV, CMV, TMV, and TRV field samples as detection templates for RT-LAMP amplification reaction, and RT-LAMP results were electrophoresed on 1.5% agarose gel and added After SYBRGreenⅠ, two methods were used to analyze directly with the naked eye. pass Figure 5 , 6 It can be seen that only in the TuMV reaction tubes there was a positive reaction and specific emerald green fluorescence, the other reaction tubes were all negative, and the three TuMV susceptible samples in the field were all positive. The results show that the RT-L...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 