Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapid test method for reverse transcription loop-mediated isothermal amplification of turnip mosaic viruses

A turnip mosaic virus, ring-mediated isothermal technology, applied in the field of biotechnology virus detection, can solve the problems of restricting the use and promotion of rapid diagnostic methods, cumbersome and complicated operating procedures, and specific limitations of detection, and achieve easy promotion and use , Improve detection efficiency and reduce detection cost

Active Publication Date: 2014-01-08
SHANDONG AGRICULTURAL UNIVERSITY +1
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are two commonly used methods for the detection of turnip mosaic virus, one is molecular biology detection method, among which PCR is the most common, but PCR requires 30-35 cycle reactions (more time-consuming) and special The instrument (PCR instrument) has cumbersome and complicated operating procedures, long time, and high technical requirements for testing personnel, which greatly limits the use and promotion of rapid diagnostic methods; the other is serological testing methods, common ones are ELISA, serum In addition to the lack of sensitivity, the specificity of the detection method is also limited
And the LAMP method overcomes the deficiencies of current two kinds of methods very well (reaction time is short, does not need special instrument, detection sensitivity is high, specificity is good), there is no report utilizing LAMP technology to detect turnip mosaic virus at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid test method for reverse transcription loop-mediated isothermal amplification of turnip mosaic viruses
  • Rapid test method for reverse transcription loop-mediated isothermal amplification of turnip mosaic viruses
  • Rapid test method for reverse transcription loop-mediated isothermal amplification of turnip mosaic viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Establishment of a reverse transcription loop-mediated isothermal amplification detection method for turnip mosaic virus

[0043] The radish samples infected with turnip mosaic virus were used as the detection object, and the healthy radish samples were used as the negative control.

[0044] 1. Primer design:

[0045] According to the nucleic acid sequence of turnip mosaic virus reported on NCBI, 8 sets of specific primers were designed by using the LAMP primer design software PrimerExplorer V4, and 4 sets of primers were preliminarily screened out according to the principles of LAMP primer design. The primer sequences are as follows (5'-3') :

[0046] First set of primers:

[0047] F3: TGCCACGATATGGTCTTC; as shown in SEQ ID NO.1;

[0048] B3: TGTTTCTCTACCGTTGTACC; as shown in SEQ ID NO.2;

[0049] FIP: CACGTATTGGAGTTCTAGAAGTCAT-AGCGCAATTTAACCGACA; as shown in SEQ ID NO.3;

[0050] BIP: CGAGAGAGGCACACATCCAG-AACGTTTCCATCCAAGCC, as shown in SEQ ID NO.4.

...

Embodiment 2

[0077] Embodiment 2: Optimization of RT-LAMP detection system

[0078] The optimal primers can be screened out by Example 1 to be the first group of primers, but the nucleic acid electrophoresis bands of the first group of primers are not very obvious, so by the two factors Mg of the main influence on the construction system 2+ Concentration and internal and external primer concentration ratio screening to determine the optimal detection system. Reaction system (25μL):

[0079] A: 10× Thermopolbuffer 2.5μL (20mM Tris-HCl, 10mMKCl, 2MmMgSO 4 , 10mM (NH 4 ) 2 SO 4 , 0.1%TritonX-100), primers (F3 and B3) in the first set of primers (F3 and B3) 0.2μM, primers in the first set of primers (FIP and BIP) 1.0μM, dNTPs 1.0mM, MgCl 2 4mM, 200U / μLM M-MLV 1.0μL, BstDNApolymerase (NEB) 1.5μL, template RNA 2.0μL;

[0080] B: 10× Thermopolbuffer 2.5μL (20mM Tris-HCl, 10mMKCl, 2MmMgSO 4 , 10mM (NH 4 ) 2 SO 4 , 0.1%TritonX-100), primers (F3 and B3) in the first set of primers (F3 and ...

Embodiment 3

[0084]Embodiment 3: Specificity and stability of RT-LAMP detection method in the present invention

[0085] According to the reaction system A and the reaction conditions of the above-mentioned Example 2, the healthy plants in the field, TuMV, BBWV, CMV, TMV, and TRV susceptible samples were tested at the same time, and the specificity and stability of the RT-LAMP method were tested. Use RNA extracted from healthy plants, leaves infected with TuMV, BBWV, CMV, TMV, and TRV field samples as detection templates for RT-LAMP amplification reaction, and RT-LAMP results were electrophoresed on 1.5% agarose gel and added After SYBRGreenⅠ, two methods were used to analyze directly with the naked eye. pass Figure 5 , 6 It can be seen that only in the TuMV reaction tubes there was a positive reaction and specific emerald green fluorescence, the other reaction tubes were all negative, and the three TuMV susceptible samples in the field were all positive. The results show that the RT-L...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid test method for reverse transcription loop-mediated isothermal amplification of turnip mosaic viruses. According to a turnip mosaic virus nucleotide sequence, a set of specific primers (F3, B3, FIP and BIP, shown in SEQIDNO.1-4) is designed, LAMP (loop-mediated isothermal amplification) reaction is performed after total RNA (ribonucleic acid) extraction, and a reaction product is subjected to turnip mosaic viruses test via a electrophoresis or fluorochrome method. The method is high in test specificity on the TuMV (turnip mosaic viruses), and has the advantages of rapidness, sensitivity, stability, efficiency, simple instrument requirements, convenience in operation, low cost and easiness in popularization and use at the grass roots.

Description

technical field [0001] The invention relates to a method for detecting turnip mosaic virus (TuMV) by using reverse transcription loop-mediated isothermal amplification (RT-LAMP) technology, and belongs to the technical field of biotechnology virus detection. Background technique [0002] Turnip mosaic virus (TuMV) is a virus distributed worldwide and is the main virus that harms cruciferous vegetables. It belongs to the family Potyviridae and belongs to the genus Potyvirus. About 720nm, 15-20nm wide, composed of 95% coat protein and 5% RNA, viral nucleic acid is single-stranded positive-sense RNA, composed of about 10,000 nucleotides. TuMV can be transmitted by 89 species of aphids including green peach aphid (Myzuspersicae) and cabbage aphid (Brevicorynebrassicae) in a non-persistent manner or by rubbing inoculation. The host range of TuMV is very wide, and it can infect 318 species of plants belonging to 156 genera in 43 families. Under natural conditions, it mainly infec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/70C12Q2531/119
Inventor 竺晓平李刚赵黎明李现道
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More