Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific primer pair and probe for detecting ALDH2 (alcohol dehydrogenase 2) gene chip

A specific, primer pair technology, applied in the field of molecular biology, can solve the problems of inaccurate detection results, difficult to meet clinical tests, long detection cycle, etc., achieve good signal-to-noise ratio, avoid uncertain factors, and simple steps.

Inactive Publication Date: 2014-01-29
SHANGHAI BAIO TECH
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current methods for determining the ALDH2 genotype mainly use methods such as polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), manual or automatic sequencing, and PCR with sequence-specific primers. Difficult to be accurate and difficult to meet the requirements of clinical testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer pair and probe for detecting ALDH2 (alcohol dehydrogenase 2) gene chip
  • Specific primer pair and probe for detecting ALDH2 (alcohol dehydrogenase 2) gene chip
  • Specific primer pair and probe for detecting ALDH2 (alcohol dehydrogenase 2) gene chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] The preparation of embodiment 1 gene chip

[0052] Artificially synthesized (Shanghai Sangon Bioengineering Technology Service Co., Ltd.) the following specific probes, dissolved in water to a concentration of 100pmol / ul solution, and then used 2× spotting buffer (product number: BST02010, Shanghai Bio-Tech Co., Ltd.), etc. Than mixed. Next, use the GSM417 sample spotting instrument of Affymetrix Company to spot on the aldehyde-modified glass slide (product number: BSM03011, Shanghai Bio Technology Co., Ltd.) according to the method described in the manual. figure 1 array of . Leave overnight at room temperature.

[0053] Each specific probe sequence is as follows:

[0054] The specific oligonucleotide probe sequence for the detection site 504Glu (GAA) is:

[0055] NH 2 -TTTTTTTTTTTTTTTT CAGGCATACACTGAAGTGAAAA; the sequence of the specific oligonucleotide probe to detect the 504Lys(AAA) site is: NH 2 -TTTTTTTTTTTTTTTTGCAGGCATACACTAAAGTGAAAACT. That is, each of th...

Embodiment 2

[0057] Example 2 Preparation of chromosomal DNA

[0058] Use the blood DNA extraction kit from Shanghai Bio-Tech Co., Ltd. and follow the instructions as follows:

[0059] Adsorption column activation:

[0060] Put the adsorption column in the collection tube, add 500 μL buffer BH1, let it stand for 2-3 minutes, and centrifuge at 12,000 rpm (9,500×g) for 30 s; discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 500 μL of buffer BH2 ​​to the adsorption column, centrifuge at 12,000 rpm (9,500×g) for 30 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube for use.

[0061] Operating procedures:

[0062] (1) Add 20 μL of proteinase K to the bottom of a 1.5 mL centrifuge tube with a pipette.

[0063] (2) Add 200 μL of blood sample into the centrifuge tube.

[0064] (3) Add 200 μL buffer BL to the centrifuge tube, shake and mix for 15 seconds.

[0065] (4) In...

Embodiment 3

[0074] Embodiment 3 uses primer provided by the present invention to amplify ALDH2 gene fragment by PCR method

[0075] Entrust Shanghai Sangon Bioengineering Technology Service Co., Ltd. to synthesize primers, and the primer information is as follows.

[0076] The primer pair sequences for amplification and detection of ALDH2 gene 504Glu / Lys are:

[0077] SEQ ID No.7: Upstream 5'-AAGACTTTGGGGCAATACAG-3',

[0078] SEQ ID No. 8: Downstream 5'-GGGTAAAATTCGGACTCTTC-3'.

[0079] Also, the 5' end of the primer was modified with biotin.

[0080] Then dissolve and dilute to 10 pmol / μl with water. The purchased Taq enzyme (TaKaRa), 10× buffer (TaKaRa), dNTP (Shanghai Sangon Bioengineering Technology Service Co., Ltd.), pure water, and the PCR amplification template obtained in Example 2 were prepared according to the formula in Table 1 below. Addition system:

[0081] Table 1

[0082]

[0083] Use a PCR instrument (TC-96 / G / H (b) PCR amplification instrument, Bioer, Hangzhou) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, and discloses a specific oligonucleotide probe for detecting an SNP (single nucleotide polymorphism) site of ALDH2 (alcohol dehydrogenase 2)gene, wherein the probe is capable of hybridizing with the 504th different genetype of the ALDH2 gene. The invention further discloses a specific primer pair for amplifying the ALDH2 gene when detecting the SNP site, and the primer pair can be used for specifically amplifying a target area containing a detection target site in the ALDH2 gene. The specific oligonucleotide probe and the specific primer pair provided by the invention can be used for detecting the ALDH2 genetype and providing information for people to learn individual alcohol metabolism detoxification ability and correctly use nitroglycerin.

Description

technical field [0001] The invention relates to the fields of molecular biology and nucleic acid detection, and specifically designs a pair of specific primers for amplifying the ALDH2 gene and a specific probe for detecting the ALDH2 gene chip. Background technique [0002] Human acetaldehyde dehydrogenase (ALDH) is a tetrameric protein that catalyzes the oxidation of acetaldehyde and other aliphatic aldehydes. There is a single nucleotide polymorphism (single nucleotide polymorphism, SNP) in exon 12 of the ALDH2 gene—rs671, and a base substitution occurs: guanine (G) → adenine (A), which leads to a codon change: GAA→AAA, and then the 504th amino acid of the enzyme changed, glutamic acid (Glu)→lysine (Lys). There are two alleles of ALDH2: wild-type (ALDH2*1, *504Glu), mutant (ALDH2*2, *504Lys). Studies have confirmed that the mutation of ALDH2 leads to significant changes in enzyme activity, which will seriously affect the metabolism of alcohol, nitroglycerin, etc., and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/156
Inventor 邢军芬朱滨孙悦张宇张莹
Owner SHANGHAI BAIO TECH