Human immunodeficiency virus-1NASBA-ELISA (enzyme-linked immunosorbent assay) detection kit
An immunodeficiency virus, detection kit technology, applied in DNA/RNA fragmentation, recombinant DNA technology, microbial determination/inspection, etc., can solve problems such as false positive results and limitations, and achieve easy promotion and high accuracy. , the effect of short time period
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
example 1
[0048] Reagent composition:
[0049] ①A pair of specific primers for HIV-1 gene
[0050] F:5'- TGATGCAAGGTCGATATGAG CTCAATAAAGCTTGCCTTGA-3', the underlined part is complementary to the detection probe; R: 5'- AATTCTAATACGACTCACTATAGGG
[0051] GGGCGCCACTGCTAGAGA-3', the underlined part is the T7 promoter sequence.
[0052] ② HIV-1 gene probe
[0053] Capture probe: 5'-Biotin-TCTGGTAACTAGAGATCCTC-3', a gene-specific probe. Detection probe: 5'-DIG-TGATGCAAGGTCGATATGAG-3'.
[0054] ③ Positive control
[0055] Human immunodeficiency virus-1 patient serum;
[0056] ④ Negative control
[0057] Normal human serum without human immunodeficiency virus-1;
[0058] ⑤NASBA Amplification Reagent:
[0059] Amplification buffer: 40 mmol / I, pH8.5 Tris-HC1, 120 mmol / L KCl, 10 mmol / L MgCl, 5 mmol / L DTT, 1 mmol / L dNTP, 10 mmol / L NTP, 100 g / L L DMSO.
[0060] Enzyme Mix: 40U SupeScript II Reverse Transcriptase, 80U T7 RNA Polymerase, 0.2U RNase H
[0061] ⑥NASBA product detection reag...
Embodiment 2
[0069] NASBA amplification and detection process
[0070] Take 0.5 μL template RNA and 10 μL reaction mixture (40 mmol / I, pH8.5 Tris-HC1, 120 mmol / L KCl, 10 mmol / L MgCl, 5 mmol / L DTT, 1 mmol / L dNTP, 10 mmol / L L NTP, 100 g / L DMSO, 0.2 μmol / L each for upstream and downstream primers), added to a 600 μL centrifuge tube, heated at 65 °C for 2 min to remove RNA secondary structures, cooled at 41 °C for 2 min; quickly added enzyme mixture to combine 5 μL (containing 40U SupeScript II reverse transcriptase, 80U T7 RNA polymerase, 0.2U ribonuclease H), the total reaction volume is 20 μL, flick and mix well, react at 41°C for 90 min, and terminate the reaction at -20°C.
[0071] ELISA detection of amplification products
[0072] Preparation of streptavidin-coated ELISA plate: Dilute streptavidin to 0.0l25mg / mL with pH8.6, 0.05mol / L carbonate buffer, coat the ELISA plate, 100μL per well , overnight at room temperature; block the plate with 1% BSA, pH 9.6, 0.05mol / L carbonate buffer, 1...
Embodiment 3
[0073] Embodiment 3: specificity experiment
[0074] Specificity test Trizol extracts the RNA of hepatitis B virus, hepatitis C virus and hepatitis A virus, and detects them by NASBA-ELISA method.
[0075] 1) Extraction of viral nucleic acid
[0076] ① Use a pipette gun to draw 20μl deinhibitor into a 0.5ml centrifuge tube;
[0077] ② Add 100μl serum sample, pipette repeatedly 3 times to mix;
[0078] ③ Add 100μl sample treatment solution A (sodium lauryl sulfate 10.0g / 100ml, Tris hydrochloride 10mmol / L (PH8.0), Triton 4.0ml / 100ml, Tween-201.5ml / 100ml, ethylenediaminetetraacetic acid 0.5mmol / L (PH8.0)), cover the tube cap, vortex and mix, centrifuge at 2000rpm for a few seconds, and react at 70°C for 10 minutes.
[0079] ④After centrifuging at 2000rpm for a few seconds, open the cap of the tube, add 110μl absolute ethanol, cap the tube, and shake to mix.
[0080] ⑤ Put the labeled nucleic acid extraction column into a 2ml centrifuge tube, and transfer all the above liqui...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More