Unlock instant, AI-driven research and patent intelligence for your innovation.

Human immunodeficiency virus-1NASBA-ELISA (enzyme-linked immunosorbent assay) detection kit

An immunodeficiency virus, detection kit technology, applied in DNA/RNA fragmentation, recombinant DNA technology, microbial determination/inspection, etc., can solve problems such as false positive results and limitations, and achieve easy promotion and high accuracy. , the effect of short time period

Inactive Publication Date: 2014-01-29
薛健 +1
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, real time RT-PCR has limited its wide application in developing countries due to the need for expensive fluorescent quantitative PCR instruments; while ordinary RT-PCR has low requirements for equipment, but it is prone to false positive results, which cannot meet the needs of patients. clinical need

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0048] Reagent composition:

[0049] ①A pair of specific primers for HIV-1 gene

[0050] F:5'- TGATGCAAGGTCGATATGAG CTCAATAAAGCTTGCCTTGA-3', the underlined part is complementary to the detection probe; R: 5'- AATTCTAATACGACTCACTATAGGG

[0051] GGGCGCCACTGCTAGAGA-3', the underlined part is the T7 promoter sequence.

[0052] ② HIV-1 gene probe

[0053] Capture probe: 5'-Biotin-TCTGGTAACTAGAGATCCTC-3', a gene-specific probe. Detection probe: 5'-DIG-TGATGCAAGGTCGATATGAG-3'.

[0054] ③ Positive control

[0055] Human immunodeficiency virus-1 patient serum;

[0056] ④ Negative control

[0057] Normal human serum without human immunodeficiency virus-1;

[0058] ⑤NASBA Amplification Reagent:

[0059] Amplification buffer: 40 mmol / I, pH8.5 Tris-HC1, 120 mmol / L KCl, 10 mmol / L MgCl, 5 mmol / L DTT, 1 mmol / L dNTP, 10 mmol / L NTP, 100 g / L L DMSO.

[0060] Enzyme Mix: 40U SupeScript II Reverse Transcriptase, 80U T7 RNA Polymerase, 0.2U RNase H

[0061] ⑥NASBA product detection reag...

Embodiment 2

[0069] NASBA amplification and detection process

[0070] Take 0.5 μL template RNA and 10 μL reaction mixture (40 mmol / I, pH8.5 Tris-HC1, 120 mmol / L KCl, 10 mmol / L MgCl, 5 mmol / L DTT, 1 mmol / L dNTP, 10 mmol / L L NTP, 100 g / L DMSO, 0.2 μmol / L each for upstream and downstream primers), added to a 600 μL centrifuge tube, heated at 65 °C for 2 min to remove RNA secondary structures, cooled at 41 °C for 2 min; quickly added enzyme mixture to combine 5 μL (containing 40U SupeScript II reverse transcriptase, 80U T7 RNA polymerase, 0.2U ribonuclease H), the total reaction volume is 20 μL, flick and mix well, react at 41°C for 90 min, and terminate the reaction at -20°C.

[0071] ELISA detection of amplification products

[0072] Preparation of streptavidin-coated ELISA plate: Dilute streptavidin to 0.0l25mg / mL with pH8.6, 0.05mol / L carbonate buffer, coat the ELISA plate, 100μL per well , overnight at room temperature; block the plate with 1% BSA, pH 9.6, 0.05mol / L carbonate buffer, 1...

Embodiment 3

[0073] Embodiment 3: specificity experiment

[0074] Specificity test Trizol extracts the RNA of hepatitis B virus, hepatitis C virus and hepatitis A virus, and detects them by NASBA-ELISA method.

[0075] 1) Extraction of viral nucleic acid

[0076] ① Use a pipette gun to draw 20μl deinhibitor into a 0.5ml centrifuge tube;

[0077] ② Add 100μl serum sample, pipette repeatedly 3 times to mix;

[0078] ③ Add 100μl sample treatment solution A (sodium lauryl sulfate 10.0g / 100ml, Tris hydrochloride 10mmol / L (PH8.0), Triton 4.0ml / 100ml, Tween-201.5ml / 100ml, ethylenediaminetetraacetic acid 0.5mmol / L (PH8.0)), cover the tube cap, vortex and mix, centrifuge at 2000rpm for a few seconds, and react at 70°C for 10 minutes.

[0079] ④After centrifuging at 2000rpm for a few seconds, open the cap of the tube, add 110μl absolute ethanol, cap the tube, and shake to mix.

[0080] ⑤ Put the labeled nucleic acid extraction column into a 2ml centrifuge tube, and transfer all the above liqui...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene detection kit against human immunodeficiency virus-1 (HIV-1). The gene detection kit comprises a pair of amplification primers, a capture probe, a detection probe, an NASBA (National Association of State Boards of Accountancy) amplification reagent and an NASBA product detection reagent. The gene detection kit provided by the invention designs the primers against the long terminal repeat sequence of the HIV-1, establishes an NASBA fast detection method and is suitable for early diagnosis of HIV-1 infection.

Description

technical field [0001] The invention relates to a NASBA (Nucleic Acid Sequence-based Amplification, nucleic acid sequence-dependent amplification) kit in the field of biotechnology, in particular to a human immunodeficiency virus-1 NASBA-ELISA detection kit. Background technique [0002] Acquired immunodeficiency syndrome is a fatal infectious disease that seriously endangers human health caused by human immunodeficiency virus (HIV). According to viral nucleic acid sequencing, HIV can be divided into two types: HIV-1 and HIV-2. Among them, HIV-1 is the main strain currently prevalent in the world and has strong variability. The results of molecular epidemiological surveys show that my country has become the HIV-1 strain. One of the most popular countries. At present, a series of methods for detecting HIV pathogens have been established in the world. The most commonly used method for detecting HIV-1 is antibody detection. However, it takes about 1 to 3 months from the time wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/70C12Q1/6804C12Q2563/131
Inventor 尹锐薛健王艳芳孙亚娟
Owner 薛健