Phytase and application thereof

A technology for phytase and phytase activity, applied in the field of phytase and its application, can solve the problems of low expression, restriction of phytase application, low heat resistance, etc. The effect of eating and improving the absorption rate

Active Publication Date: 2014-02-19
QINGDAO VLAND BIOTECH GRP +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Phytases from different sources have different enzymatic properties, but the current phytases generally have problems of low heat resistance and low expression, which restrict the wider application of phytases in the field of feed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phytase and application thereof
  • Phytase and application thereof
  • Phytase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1: Cloning of phytase gene

[0021] Genomic DNA was extracted from overnight cultures of P. niger using the Fungal Genomic DNA Extraction Kit (Omega).

[0022] The phytase gene in Botrytis niger is amplified as the amplification template with Genomic DNA of Botrytis niger, wherein the forward primer P-F sequence used is (the sequence shown in the underline is the AflII restriction site);

[0023] 5′-AAA CTTAAG ATCATGGCCTGCGTCGCCTTCCTGCTCG-3′

[0024] The P-R sequence of the reverse primer is (the underlined sequence is the XbaI restriction site):

[0025] 5′-TCG TCTAGA TCAAGCGGGTGCGCCGTCCGTCACAGTG - 3'

[0026] The gene was amplified from P. niger genomic DNA using Phusion DNA polymerase (Thermo scientific).

[0027] The above PCR product was purified using a gel purification kit (Fermentas). The purified PCR product was digested with restriction endonucleases AflII and XbaI (Fermentas); meanwhile, the plasmid pGm was digested with restriction endonu...

Embodiment 2

[0030] Embodiment 2: Construction and verification of engineering strains of Aspergillus niger

[0031] Draw the Aspergillus niger G1 spore suspension in the center of the CMA plate (9cm petri dish), wait for the colony to cover the whole petri dish, cut 1 / 4 size of the culture based on 200mL CMA liquid medium, culture at 30°C, 200rpm for 14~ 16h.

[0032] Collect the mycelium with a sterile Miracloth filter cloth, and wash it once with solution A, transfer the washed mycelium to 40mL protoplastization solution under aseptic conditions, and incubate at 30°C and 200rpm for 1-2h, The progress of protoplast transformation was detected by microscopic observation.

[0033] Filter the above-mentioned warm bath liquid with a sterile Miracloth filter cloth, and the obtained filtrate is the protoplast solution. The protoplast solution was divided into two 50mL sterile disposable centrifuge tubes, and the volume of each tube was adjusted to 45mL with solution B, centrifuged at 4000rpm...

Embodiment 3

[0046] Embodiment 3: the fermentation of aspergillus niger engineering bacterium and the expression of phytase

[0047] Pick the positive transformant Aspergillus niger WLScphy obtained in Example 2, inoculate it in 30mL TSB fermentation medium, and cultivate it at 30°C and 200rpm for 5d; the obtained fermentation broth is filtered with 8 layers of gauze, and the filtrate is centrifuged at 14000g for 10min , to collect the supernatant; the supernatant was electrophoresed on a 12% SDS-PAGE gel. The result is as figure 2 Shown, swimming lane 2 shows the expression situation of Aspergillus niger host protein; Swimming lane 1 shows the expression situation of Aspergillus niger WLScphy protein of the present invention, wherein the 59kDa place indicated by the arrow has the target protein band, which is consistent with expectations, indicating that the plant of the present invention Acidase was successfully expressed in Aspergillus niger. The BCA protein concentration assay kit (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims to provide novel phytase and an application thereof. An amino acid sequence of the phytase is represented by SEQ ID NO:1. The recombined phytase is used as a feed additive and can remarkably increase the daily feed intake and the daily gain of broiler chickens, reduce the feed conversion ratio and increase the economic benefit of farmers. In addition, if the recombined phytase is added into daily rations, the phosphate excretion quantity of the broiler chickens can be reduced by 13.8% in comparison with a control group, and the phenomenon indicates that the phytase can effectively increase the absorptivity of phosphorus in feed by the broiler chickens, can reduce excretion of phosphorous waste and is beneficial to protection of the ecological environment.

Description

technical field [0001] The invention belongs to the technical field of functional gene screening, and in particular relates to a phytase and application thereof. Background technique [0002] Phytase, phytase (EC3.1.3.8), is a general term for a class of enzymes that catalyze the hydrolysis of phytic acid and phytate into inositol and phosphoric acid (or phosphate). [0003] As an excellent feed additive, phytase is currently widely used in animal husbandry production. It can improve the utilization rate of phosphorus, protein, amino acids, and various mineral elements in animals, and relieve animal and plant feed. The anti-nutritional effect of phytic acid can improve the nutritional value of plant feed and reduce the pollution of animal excrement to the environment. It is an extremely effective additive in animal production and environmental protection, and has important application value. In addition, the "National Livestock and Poultry Breeding Pollution Prevention and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/16C12N15/55C12N15/80C12N1/15A23K1/165C12R1/685C12R1/645
CPCA23K20/189A23K50/70C12N9/16C12Y301/03008
Inventor王华明徐娟黄亦钧
OwnerQINGDAO VLAND BIOTECH GRP