Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof

A peanut allergen and Lactococcus lactis technology, applied in the field of bioengineering, can solve the problems that hinder the large-scale promotion and application of the Escherichia coli expression system, and achieve the effect of reducing side effects and avoiding allergic reactions

Inactive Publication Date: 2014-03-12
JIANGNAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Escherichia coli produces endotoxin, and its expression product requires subsequent purification, which hinders the large-scale promotion and application of Escherichia coli expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof
  • Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof
  • Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1 The acquisition of hypoallergenic gene mArah2

[0020] (1) Optimization of natural peanut allergen gene Arah2:

[0021] The signal peptide sequence was deleted in the amino acid sequence of Arah2 (genbank: AAN77576.1), and the codon optimization of the Arah2 gene sequence was carried out in combination with the codon preference of Lactococcus lactis, and subcloned into pUC57 to obtain a natural allergen optimization Plasmid pUC57-nArah2 of the gene nArah2 (synthesized by Shanghai Sangon, where pUC57 is a commercialized plasmid).

[0022] (2) Modified mutation of natural allergen optimization gene nArah2:

[0023] The aa47-56 antigenic epitope is disconnected and rearranged according to the amino acid sequence of 50-151-1-49 to obtain the peanut allergen gene mArah2 with low allergenicity. The relevant sequence is as follows:

[0024] Native gene sequence before optimization (genbank: AY158467.1), SEQ ID No.1.

[0025] The optimized gene sequence (mArah2...

Embodiment 2

[0028] Example 2 Construction of recombinant expression vector containing hypoallergenic gene mArah2

[0029] Rearrangement and splicing of target fragments aa1-49 and aa50-151: Using the plasmid pUC57-nArah2 (synthesized by Shanghai Sangon, where pUC57 is a commercialized plasmid) as a template, use primers P1F: CAGGTGGTCGTGATCGTTA TCGTCAACAATGGGAATTAC / P1R: CCCTCGAGATCTTGTGATGGTGAATATG and primers P2F :CGCCATAT GCCATATTTCTCTTCACAAG / P2R:GTAATTCCCATTGTTGACG ATAACGATCACGACCACCTG Amplifies aa1-49 and aa50-151 fragment genes. The PCR products of the two gene fragments were detected and purified by 1% agarose gel electrophoresis. The target fragments aa1-49 and aa50-151 were spliced ​​by overlapping region amplification gene splicing method. The amplification system is as follows (total volume: 50 μL): 10×KOD plus buffer: 5 μL; dNTP: 5 μL; MgSO4: 2 μL; template 1-49: 2 μL; template 50-151: 2 μL; KOD enzyme: 0.5 μL; μL. After 5 cycles, add 1 μL each of the upstream and downstream...

Embodiment 3

[0030] The preparation of embodiment 3 recombinant Lactococcus lactis

[0031] The ligation reaction product above was transformed into L. lactis NZ9000 (Kuipers et al. Quorum sensing-controlled gene expression in lactic acid bacteria. Journal of Biotechnology. 1998, 64(1): 15-21) competent cells by electroporation. The transformants were picked for sequencing verification, and the recombinant plasmids and transformants with correct sequencing were named pNZ8148-mh2 (self-constructed) and L.lactis NZMH respectively. L.lactis NZ9000 and L.lactis NZ9000 strains recombinantly expressing nArah2 protein Named L. lactis NZ and L. lactis NZNH.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof. According to the invention, on the basis of retaining natural peanut allergen Arah2 protein immunogenicity, the allergenicity is lowered, codon optimization and modified mutation are performed on Arah2 so as to obtain an optimized gene mArah2, and recombinant expression vectors and recombinant lactococcus lactis strains aiming at mArah2 are built. By using the recombinant strains in the invention for rat immunization, peanut allergy can be effectively restrained, and the immune protection effect is remarkable. Therefore, the lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen have a great potential on the aspect of curing peanut allergy.

Description

【Technical field】 [0001] The invention relates to a recombinant Lactococcus lactis strain expressing hypoallergenic peanut allergen mArah2, its construction method and application, and belongs to the technical field of bioengineering. 【Background technique】 [0002] Peanut allergy is the most common food allergic reaction with a high incidence and can cause severe or even fatal clinical symptoms. Peanut allergy is usually lifelong and generally less susceptible to immune tolerance with age. Currently, specific immunotherapy is an effective treatment for peanut allergy. However, most of the traditional specific immunotherapy uses crude extracts of allergens, which have a small amount of extraction and low purity. It is a simple and feasible method to recombine and express allergen protein by using genetic engineering method. In the patent "A Recombinant Peanut Allergen and Mutant and Its Preparation and Application", Tao Ailin et al. used Escherichia coli as the expression...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/74C12N15/29C12N1/21A61K39/35A61P37/08C12R1/46
CPCC07K14/415A61K39/00
Inventor 陈卫张秋香任晟诚王刚田丰伟刘小鸣赵国忠赵建新张灏郭敏
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com