Huperzia serrate endophytic fungus and application of huperzia serrate endophytic fungus in preparation of 8alpha,15alpha-epoxydized huperzine A
A technology of Huperzia serrata and endophytic fungi is applied in the field of biochemistry, which can solve the problems of low transformation rate, shortage of clinical drugs, and inability to meet industrial production needs, and achieves the effects of high transformation rate, easy strain and simple fermentation conditions.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Isolation of the endophytic fungus (Ceriporia lacerate) HS-ZJUT-C13A of Hupernia serrata
[0044] (1) Collection of samples
[0045] The samples were Huperzia serrata plants collected from Gaoer Township, Pan'an County, Jinhua City, Zhejiang Province in August 2010.
[0046] (2) Isolation of strains
[0047] Wash the epidermis and roots of the collected plants with tap water, immerse the washed samples in a container filled with 75% ethanol, take them out after 2 minutes, rinse them with sterile water for 3 to 5 times, and then immerse them in a container filled with 0.1% ethanol Keep it in the container of mercuric chloride solution for 1 minute, take it out, and rinse with a large amount of sterile water to remove the residual mercuric chloride solution. Under sterile conditions, use sterilized tweezers and blades to peel off the outer skin of the stems of Huperus serrata stems, then cut into 0.3cm×0.3cm tissue pieces and plant them on PDA medium, and cult...
Embodiment 2
[0050] Example 2 Molecular Biological Identification of Hupernia lacerate HS-ZJUT-C13A
[0051] (1) Extraction of DNA
[0052] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelium with liquid nitrogen, and extract the genomic DNA with the SK1375 genomic DNA extraction kit (manufacturer: Sangon Bioengineering (Shanghai) Co., Ltd.) Sugar gel electrophoresis.
[0053] (2) PCR amplification of ITS region sequence
[0054] The primer sequences are: ITS1: 5'TCCGTAGGTGAACCTGCGG3'; ITS4: 5'TCCTCCGCTTATTGATATGC3'.
[0055] The PCR system (50 μL) is composed of: Template (genome) 10 pmol, Primer 1 (10 μM) 1 μL, Primer 2 (10 μM) 1 μL, dNTP mix (10Mm each) 1 μL, 10×Taq reaction Buffer 5 μL, Taq (5U / μL) 0.25 μL , add water to 50 μL.
[0056] The PCR program was set as follows: 98°C pre-denaturation for 5 minutes, 95°C denaturation for 35 seconds, 55°C renaturation for 35 seconds, 72°C extension for 40 seconds, 35 cycles, an...
Embodiment 3
[0072] Example 3 The method for preparing 8α, 15α-epoxidized huperzine A by transformation of endophyte (Ceriporia lacerate) HS-ZJUT-C13A
[0073] (1) Strain activation
[0074] Potato glucose agar medium: 200g of peeled potatoes, 20g of glucose, 15g of agar, 1000mL of water, make a test tube slope, pick mycelium and inoculate it on the test tube slope, culture at 28°C for 7 days;
[0075] (2) Fermentation and transformation
[0076] Potato glucose liquid medium: 200g peeled potatoes and cut into about 2cm 2 Put the small pieces in a beaker and boil for 30 minutes, then filter with double gauze, take the filtrate and add 20g of glucose, add water to make up to 1000mL.
[0077]Inoculate 350 250mL Erlenmeyer flasks (with 100mL potato dextrose liquid medium in the bottle, which has been sterilized at 121C) with the activated Ceriporia lacerate HS-ZJUT-C13A strain, at 28°C, Shake culture at 180 rpm. After culturing for 6 days, under aseptic conditions, add 0.3 mL of huperzine ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 