Signal peptide capable of improving secretion efficiency, and applications thereof

A signal peptide and high-efficiency technology, applied in the field of signal peptides, can solve the problems of low L-asparaginase content, complex extraction process, and low L-asparaginase output, so as to improve secretion capacity, reduce production costs, Effect of Enzyme Production Ability Improvement

Active Publication Date: 2015-04-15
JIANGNAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the content of L-asparaginase in animal serum is low, and the extraction process is complicated, microorganisms have the advantages of easy cultivation and low cost, which have become the focus of scholars' research. The L-asparaginase-producing microorganisms currently studied mainly include Escherichia coli, Erwinia carotovora, Erwinia chrysanthemi, etc., but the yield of L-asparaginase in wild strains is low. In recent years, genetic engineering technology has been used to clone the L-asparaginase gene into Escherichia coli to obtain high-efficiency expression of L-asparaginase. The use of engineering bacteria to produce L-asparaginase has become an important source

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Signal peptide capable of improving secretion efficiency, and applications thereof
  • Signal peptide capable of improving secretion efficiency, and applications thereof
  • Signal peptide capable of improving secretion efficiency, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1 A kind of novel signal peptide

[0026] The nucleotide sequence of the signal peptide (WapA-SP) provided by the present invention is shown in SEQ ID NO.1: ATGAAAAAAAGAAAGAGGCGAAACTTTAAAAAGGTTCATTGCAGCATTTTTAGTGTTGGCTTTAATGATTTCATTAGTGCCAGCCGATGTACTAGCAAAAATCTACA or is modified from the sequence of SEQ ID NO.1, but the signal peptide function is still performed and the secretion efficiency does not occur A fundamentally altered nucleotide sequence. The above-mentioned signal peptide sequence is obtained by chemical total synthesis or by PCR method.

[0027] The above target signal peptide WapA-SP was cloned into the vector pMA5 to construct the plasmid pMA0911-wapA-SP, and the transformant was sequenced by Shanghai Sangon after the enzyme digestion was verified to be correct.

[0028] In this study, by fusing the signal peptide, the secretion pathway of asparaginase is changed to SEC secretion mode, which can increase the secretion of asparaginase and furth...

Embodiment 2

[0029] Embodiment 2 asparaginase gene acquisition

[0030] The PCR primers G19Sence and G19Antisence of L-asparaginase gene were designed according to the ansZ gene sequence in the NCBI whole genome nucleic acid sequence of Bacillus subtilis. The ansZ gene lacking the signal peptide (19 N-terminal amino acids) was amplified by PCR.

[0031] G19Sence:CCG GAATTC TGTTCACATTCTCCTGAAACAA (EcoR I)

[0032] G19Antisence:CGC GGATCC TCAATACTCATTGAAATAAGCTTG (BamH I)

[0033] Using pET22b-ansZ (Shanghai Sangong Synthetic) as a template, use the primers provided above for PCR amplification, PCR conditions: 98°C pre-denaturation, 3min, one cycle; 98°C denaturation, 30s, 50°C annealing, 30s, 72 ℃ extension, 70s, 34 cycles; 72°C, 10min, one cycle; 12°C, 10min, one cycle. PCR amplification system: template 1 μL, upstream and downstream primers 1 μL, dNTP Mix 4 μL, 5×primeSTAR Buffer 10 μL, sterilized double distilled water 32.5 μL, primeSTAR DNA polymerase 0.5 μL. The gel recovery ki...

Embodiment 3

[0034] Example 3 High-efficiency secretion of asparaginase strain construction

[0035] The target gene ansZ was ligated with the vector pMA0911-wapA-SP, the ligation system: 4 μL of the target gene, 1 μL of the vector pMA0911-wapA-SP, 5 μL of solution I, ligated overnight at 16°C. Transform the ligated recombinant plasmid pMA0911-wapA-SP-ansZ into competent E.coil JM109, and use ampicillin LB plates to pick positive colonies. The plasmid was extracted after overnight culture on a shaker at 37°C and named pMA0911-wapA-SP-ansZ. After the enzyme digestion was verified to be correct, the transformants were sequenced by Shanghai Sangon.

[0036] Transform the plasmid with correct sequencing into Bacillus subtilis WB600 to obtain asparaginase-producing genetically engineered bacteria.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a signal peptide capable of improving secretion efficiency. A nucleotide sequence is shown in 1) or 2): 1) the nucleotide sequence is shown as SEQ ID NO.1; 2) after transforming the SEQ ID NO.1 sequence, the nucleotide sequence still performs the function of signal peptide and the secretion efficiency of the nucleotide sequence does not have fundamental change. The invention provides a signal peptide capable of improving the secretion efficiency, the secretion capability of strains can be remarkably improved after the signal peptide is used, and the enzyme activity of asparaginase can be improved by 1.5 times. The enzyme production capability of the transformed strains is remarkably improved, and the transformed strains are more suitable for industrial application, the production cost can be lowered, and the production efficiency can be improved.

Description

technical field [0001] The invention relates to a signal peptide with improved secretion ability, especially a signal peptide with improved asparaginase activity. technical background [0002] L-asparaginase (EC3.5.1.1) is a protease with anticancer activity, which can specifically catalyze the hydrolysis of L-asparagine into aspartic acid and NH 3 . The physiological effect of L-asparaginase is mainly manifested as the inhibitory effect on some tumors, especially effective on acute leukemia and malignant lymphoma. L-asparaginase has become a very effective drug for treating leukemia and has no inhibitory effect on bone marrow cells. [0003] L-asparaginase can reduce the formation of acrylamide in food. Acrylamide is mainly produced by the Maillard reaction of reducing sugar and asparagine in food raw materials during high-temperature heating. Adding asparaginase to food can hydrolyze asparagine and reduce the formation of acrylamide from the source. [0004] Some micro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/00C12N1/21C12R1/125
CPCC07K14/00C12N9/82C12Y305/01001
Inventor陈坚冯岳刘松堵国成王彬晨陈璇
OwnerJIANGNAN UNIV