Novel cellobiohydrolase enzymes

A cellobiose, hydrolase technology, applied in hydrolase, glycosylase, enzyme and other directions, can solve the problem of irrelevance of performance and activity

Inactive Publication Date: 2014-07-30
IOGEN ENERGY CORP
View PDF25 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although soluble chromogenic and fluorogenic substrates have been developed for detection of GH enzyme activity and used in certain screening assays, the performance of GH enzymes on these artificial substrates is often Not relevant for activity on substrates such as cellulose or xylan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel cellobiohydrolase enzymes
  • Novel cellobiohydrolase enzymes
  • Novel cellobiohydrolase enzymes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0188] Example 1 describes the strains and vectors used in the following examples. Example 2 describes the cloning of the TrCel7A gene and the preparation of a site-saturation mutagenesis library of TrCel7A. Example 3 describes the preparation of a random mutagenesis library of TrCel7A. Example 4 describes the transformation of a T. reesei host strain with a genetic construct expressing an isolated cellobiohydrolase. Example 5 describes the expression of wild-type and isolated TrCel7A cellobiohydrolase from microcultures. Example 6 describes the sequencing of polynucleotides encoding isolated cellobiohydrolases. Examples 7 to 12 describe high-throughput screening assays for identifying isolated cellobiohydrolases with improved activity on processing substrates.

[0189] Example 1: Strains and vectors

[0190] E. coli strain DH5α (F-ф80lacZΔM15Δ(lacZYA-argF)U169recA1endA1hsdR17(rk-,mk+)phoA supE44thi-1gyrA96relA1λ-) was obtained from Invitrogen (cat. No. 18265-017 and / or 18...

Embodiment 2

[0192] Example 2: Site Saturation Mutagenesis (SSM) of TrCel7A

[0193] a. SSM PCR

[0194] A site-saturation mutagenesis (SSM) library of TrCel7A was generated using primers containing degenerate codons (NNS) targeting multiple amino acid positions. SSM was performed using a two-step PCR method involving Megaprimer synthesis followed by PCR-mediated overlap extension. Use iProof TM High-fidelity DNA polymerase (Bio-Rad) was used for PCR reactions. A vector containing genomic DNA encoding TrCel7A with flanking sequences (SEQ ID NO: 384) was used as a template for the L375X library. A vector containing genomic DNA encoding TrCel7A-R449E-R450E with flanking sequences (SEQ ID NO:385) was used as template for all other SSM libraries.

[0195] For each SSM library, MegaPrimer A was amplified using the outer forward primer AC639 and the inner mutagenic reverse primer, while MegaPrimer B was generated by combining the outer reverse primer AC640 with the inner mutagenic forward pr...

Embodiment 3

[0205] Example 3: Random mutagenesis of TrCel7A

[0206] a. Error-prone PCR

[0207] Use by error-prone PCR II DNA polymerase (Agilent) generated random mutagenesis libraries. Two error-prone PCRs were performed. One reaction used 20 fmol of the vector containing the polynucleotide encoding TrCel7A-R449E-R450E and flanking sequences (SEQ ID NO: 442). Another error-prone PCR was performed using 100 fmol of the vector containing the polynucleotide encoding TrCel7A and flanking sequences (SEQ ID NO: 443). Both reactions contain II DNA polymerase and primers AC639 and AC640. The annealing temperature was set at 60 °C and continued for 20 cycles to complete the amplification. Use Wizard Error-prone PCR amplicons were subjected to agarose gel electrophoresis using the Gel and PCR Purification System (Promega), and approximately 1.6 kb amplicons were purified from the gel. The primer sequences are shown below:

[0208] AC639: 5'CCGCACTCCCCATCCCCTACCATCTATCCGAACTTCCCCGTC (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are isolated cellobiohydrolases comprising a modified Glycoside Hydrolase (GH) Family 7 catalytic domain, a GH Family 7 catalytic domain and a modified Family carbohydrate binding module (CBM), or both a modified Family 7 catalytic domain and a modified Family 1 CBM. Such isolated cellobiohydrolases exhibit from 45% to about 99.9% amino acid sequence identity to amino acids 1- 436 of SEQ ID NO: 1 or to amino acids 1-438 of SEQ ID NO: 2 and improved activity on process substrates. Also provided are genetic constructs and genetically modified microbes for expressing the isolated cellobiohydrolases, a process for producing the isolated cellobiohydrolases, cellulase enzyme mixtures comprising the isolated cellobiohydrolase and a process for hydrolysing a cellulosic substrate with such cellulase enzyme mixtures.

Description

technical field [0001] The present invention relates to isolated cellobiohydrolases. More specifically, the present invention relates to isolated glycosyl hydrolases family 7 cellobiohydrolases. The present invention also relates to a genetic construct comprising a nucleotide sequence encoding an isolated cellobiohydrolase, a method for producing said isolated cellobiohydrolase from a host strain, and said isolated cellobiohydrolase Use of enzymes in the hydrolysis of cellulose. Background technique [0002] Lignocellulosic feedstock is a promising alternative to corn starch for the production of fuel ethanol. These raw materials are widely available, inexpensive, and several studies have concluded that cellulosic ethanol produces near-zero greenhouse gas emissions. [0003] However, these raw materials cannot be easily degraded into their complex sugar molecules. The refractory problem of lignocellulose can be partially overcome by physical and / or chemical pretreatment....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N1/14C12N1/15C12N1/19C12N15/59C12N15/80
CPCC12N9/2437C12N15/80C12P19/14C12Y302/01091
InventorJ·蒙塔利特L·古达内特-塞维奇C·希尔C·D·欣德利J·A·拉维尼N·玛斯里F·塔罕J·J·托马舍克
OwnerIOGEN ENERGY CORP