Spinner-flask culture method for H9N2 subtype of avian influenza virus

The technology of a bird flu virus and culture method is applied in the fields of cell culture and H9N2 subtype bird flu virus spin bottle culture, which can solve the problems of poor immune effect and low virus titer, achieve significant technological progress, and improve immunity effect, effect of high viral titer

Inactive Publication Date: 2014-10-01
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a kind of bottle-transfer culture method of H9N2 subtype avian influenza virus, the method for the bottle-transfer culture of described this H9N2 subtype avian influenza virus will solve the virus drop in the poultry cell vaccine in the prior art The degree is not high, which leads to the technical problem of poor immune effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Spinner-flask culture method for H9N2 subtype of avian influenza virus
  • Spinner-flask culture method for H9N2 subtype of avian influenza virus
  • Spinner-flask culture method for H9N2 subtype of avian influenza virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Rescue and verification of embodiment 1SH441 / PR8 (NS2E67&74S) mutant virus

[0034] 1. Construction of recombinant plasmid pBD-NSE67 / 74S

[0035] PR8 virus strain NS2 gene mutation: using the plasmid with PR8NS gene (refer to Chinese Veterinary Science, 2010, 40: 788)) as a template, using Pyrobest DNA polymerase (TakaRa), using SapI-NS-F, PR8-NS2- 204R, PR8-NS2-193F, SapI-NS-R (Table 1) were amplified by PCR respectively. The obtained two PCR products 1 and 2 were purified by tapping rubber. Using the above two purified PCR products as templates, PCR amplification was performed with SapI-NS-F and SapI-NS-R (Table 1) to obtain PCR product 3. The purified PCR product 3 and the PBD vector were respectively digested with BSPQI (NEB), then ligated and transformed into JM109 competent cells. Pick the positive bacteria and extract the plasmid. The suspected positive recombinant plasmid PBD-NS2E67 / 74S identified by PCR was sent to the company for sequencing verification. ...

Embodiment 2

[0050] Example 2: Establishment of MDCK cell lines stably expressing HA protein

[0051] 1. Construction of recombinant plasmid pMX-HA

[0052] Using the H5 gene (NCBI accession No NC_007362) as a template, add 19.5 μl of sterilized double distilled water, 2.5 μl of 10×PCR buffer, 1 μl of dNTP Mix (10mmol / L), 10umol / L upstream primer (sequence: GCGGCCGC AAAATGGAGAAAATAGTGC (SEQ ID NO: 1), the underlined part is the NotI restriction site) 1 μl, 10 μmol / L downstream primer (the sequence is: CTCGAG TTAAATGCAAATTCTGCATTG (SEQ ID NO: 2), the underlined part is the XhoI restriction site) 1 μl, Taq Plus DNA polymerase (TAKARA) 0.5ul, mix well, enter into PCR reaction. PCR amplification conditions: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 15 s, annealing at 53°C for 15 s, extension at 72°C for 2 min, a total of 30 cycles, and a final incubation at 72°C for 10 min.

[0053] After the PCR product was purified and recovered by the kit (Axygen Company), it was subc...

Embodiment 3

[0060] Example 3: Validation of Cell Lines

[0061] 1. Identification by indirect immunofluorescence

[0062] When the MDCK-HA cells reached 90%, wash the cells with PBS and shake dry. Cells were permeabilized and fixed with a mixture of acetone and methanol at -20°C, followed by washing with PBS. Cells were incubated with PBS-M-T (containing 5% skimmed milk powder, 0.05% Tween-20, 0.1% Triton X-100) at 37°C for 90min. Wash 3 times with 200 μL PBST containing 0.25% Tween-20, 3 min each time. Add the H5 polyclonal antibody (or commercially available H5 antibody, such as Influenza A Hemagglutinin H5 (Avian H5N1) mAb ( www.antibodies-online.com / terms.htm , Germany), and incubated at 37°C for 1h. Clean as above. Add PBS-M-T to dilute 50 μL FITC-goat anti-mouse IgG (KPL, 1:200), incubate at 37°C for 1 hour, and wash as above. Finally, use an inverted fluorescent microscope (OLYMPUS) to observe the results and take pictures for records. For details, see figure 2 . The expe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a spinner-flask culture method for H9N2 subtype of avian influenza virus. The spinner-flask culture method comprises a step of culturing MDCK (Madin-Darby canine kidney)-HA cells, namely culturing the MDCK-HA cells in a spinner flask; a step of inoculating the MDCK-HA cells with the H9N2 subtype of avian influenza virus; particularly, in the inoculating step, when monolayer cells in the cells growing in the spinner flask are more than 90%, the H9N2 subtype of avian influenza virus is inoculated and incubated for 1-2 hours in a cell incubator, and 50ml of 2% NCS (new-born calf serum) DMEM (Dulbecco modified eagle medium) maintenance solution is added after the incubation is ended, and the cells inoculated with the H9N2 subtype of avian influenza virus are cultured in the cell incubator, and finally cell supernatant is collected. According to the spinner-flask culture method disclosed by the invention, the MDCK-HA cell system is adopted, and the conditions of spinner-flask culture are optimized, thus the H9N2 subtype of avian influenza virus is rapidly proliferated to reach a high virus titer and obtain a good immune effect.

Description

Technical field: [0001] The invention belongs to the field of bioengineering, and in particular relates to a method for culturing cells, in particular to a method for cultivating H9N2 subtype avian influenza virus in spinner bottles. Background technique: [0002] Avian Influenza (AI) is a highly contagious disease of poultry caused by Avian Influenza Virus (AIV) of the Orthomyxoviridae family. There are 16 HA subtypes and 9 NA subtypes. According to the different pathogenicity of avian influenza virus, it can be divided into highly pathogenic avian influenza virus and low pathogenic avian influenza virus. At present, the low pathogenicity avian influenza epidemic in my country is mainly dominated by the H9 subtype. Since my country first reported the isolation of H9N2 subtype AIV from chickens in 1994, this subtype of avian influenza virus has been widely distributed in Liaoning, Anhui, Shandong, Guangdong, Fujian, Jiangsu, Henan, Hunan, Hubei, Shanghai, Guangxi, Yunnan, M...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/00C12R1/93
Inventor李泽君滕巧泱
OwnerSHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI