Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapeseed Seed Production Method Using Herbicide Resistance Gene

A herbicide-resistant gene and rapeseed technology, applied in botany equipment and methods, plant gene improvement, application, etc., can solve the problems of reducing seed production yield, restricting the production scale of hybrids, increasing production costs, etc.

Inactive Publication Date: 2016-08-24
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When spraying CHA, in order to avoid the reduction of seed production due to the decrease of pollen amount caused by the phytotoxicity of the male parent, artificial shading measures must be taken to protect the male parent row plants, which not only increases the production cost, but also restricts the production scale of hybrids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapeseed Seed Production Method Using Herbicide Resistance Gene
  • Rapeseed Seed Production Method Using Herbicide Resistance Gene
  • Rapeseed Seed Production Method Using Herbicide Resistance Gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: Obtaining of tribenuron-methyl-resistant Brassica napus strains

[0035] (1) Weigh 1000g of high-quality homozygous Huashuang No. 5 seeds (this material is provided by the Rape Genetics and Breeding Research Office of Huazhong Agricultural University, which is a new variety of Brassica napus popularized in China), and soak the seeds in double distilled water 8 hours. The soaked seeds were placed in 0.30% chemical mutagen ethyl methanesulfonate (EMS) and stirred in time to make them fully mutagenized. After 18 hours of mutagenesis, rinse with tap water for 3-4 hours, and slightly dry the mutagenized seeds.

[0036] (2) Sow untreated Huashuang No. 5 in the experimental field of Huazhong Agricultural University, sow 8 plants in each row, and spray 0mg / L twice every other week after 4-6 true leaves, design 0.01mg / L, 0.025 mg / L, 0.5mg / L, 2.5mg / L, the herbicide tribenuron-methyl solution of different concentrations of 5.0mg / L, observe the phenotype after 20 da...

Embodiment 2

[0041] Example 2: Cloning of Tribesulfuron-methyl-resistant Gene in Brassica napus

[0042] (1) Utilize the CTAB method (a common method in this field) to extract the genomic DNA of Brassica napus Huashuang 5 (wild type) and resistant strains, and use specific primers (as shown below) to identify genes that may be associated with resistance The Open-reading frame (ORF) of two AHAS homologous genes (AHAS1, AHAS3) in Brassica napus were amplified separately. The amplification primers of BnaAHAS1 gene (gene accession number Z11524) are BnaAHAS1-F (TCAAGAACAGTTAGATCCAC) and BnaAHAS1-R (GATCACCAGCTTCATCTCT); the amplification primers of BnaAHAS3 gene (gene accession number Z11526) are BnaAHAS3-F (CTCTCTCTCTCTCATCCAT) and BnaAHAS3-R (ACTGAAACTAAGTCTTTTTACCAT).

[0043] (2) KOD-plus-standard reaction system (TOYOBO) was used for gene amplification. The 50μl PCR reaction system included: 100ng genomic DNA template, 5μl 10×PCR buffer for KOD-plus-, 5μl dNTPs (2mM), 2μl MgSO 4 (25mM),...

Embodiment 3

[0051] Example 3: Identification of the mutation site of the tribenuron-methyl-resistant gene in Brassica napus

[0052] (1) Using Clustal Omega (http: / / www.ebi.ac.uk / Tools / msa / clustalo / ) to compare the BnaAHAS1 and BnaAHAS3 gene sequences of the wild-type and resistant strains.

[0053] The result is as Figure 7As shown, in the resistant strain M45, the BnaAHAS3 gene had two mutation sites, namely base 96 and base 536, where cytosine (C) was mutated to thymine (T).

[0054] (2) The amino acid sequences of the two genes of the wild-type Huashuang 5 and the resistant strain M45 were compared, analyzed and displayed using the same method as above.

[0055] The result is as Figure 7 As shown, the 197th proline (Pro) of the BnaAHAS3 gene of the resistant strain M45 has been mutated into leucine (Leu) (using the Arabidopsis amino acid position nomenclature, see: gene accession number At3g48560, http : / / www.arabidopsis.org / ); this mutation site is consistent with the 17 herbic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of crop marker-assisted breeding, and in particular relates to a rapeseed chemical male-killing seed production method using a herbicide-resistant gene. Features of the invention include breeding chemical andricide-tolerant male material and an unshielded chemical andricide step. Using chemical mutagen to mutate Brassica napus seeds, spraying the herbicide tribenuron-methyl at the 5-6 leaf stage, preliminary screening to obtain herbicide-resistant mutant materials, and self-crossing to obtain stable herbicide-resistant rapeseed mutant strains Line, extract the rapeseed mutant strain genomic DNA, amplify to obtain BnaAHAS1 and BnaAHAS3 gene fragments, wherein the nucleotide sequence of the BnaAHAS3 gene fragment is shown in SEQ ID NO: 1, there is a C / T at the 536bp of the gene BnaAHAS3 mutation. The invention also discloses the preparation of the herbicide-resistant specific marker and its application in unshielded chemical male killing seed production.

Description

technical field [0001] The invention belongs to the technical field of marker-assisted breeding of crops, and in particular relates to a rapeseed chemical maleicidal seed production method using a herbicide-resistant gene, which includes screening mutants resistant to sulfonylurea herbicides by using chemical mutagens and herbicides, from The herbicide-resistant gene AHAS is cloned from the mutant, and the fragment of the gene is used as a molecular marker to assist selection of herbicide-resistant rapeseed lines, so as to improve the method of chemical male-killing seed production of rapeseed. Background technique [0002] Brassica napus is an important oil crop widely grown in the world. Rapeseed oil can not only be used as edible oil, but also industrial raw materials such as lubricating oil and biodiesel. In the nearly 40 years from 1975 to 2012, the total world production of Brassica napus has increased by 8 times, and the total production in 2012 reached 64.8 million ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11A01H1/02C12Q1/68
Inventor 刘克德吴江生刘超李海涛李娟娟赵波
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More