Hemicellulase-based engineering bacteria and realization method thereof

A technology of hemicellulase and engineering bacteria, applied in the field of engineering bacteria based on xylanase and xylosidase, can solve the problem of inability to simultaneously ferment β-xylanase and β-xylosidase, and hydrolyze hemicellulose Insufficient thoroughness and other problems to achieve the effect of improving protein activity and solubility and ensuring quality

Inactive Publication Date: 2014-11-19
SHANGHAI JIAO TONG UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the technology cannot ferment β-xylanase and β-xylosidase at the same time, and the fermentation and hydrolysis of hemicellulose is not thorough enough to meet the needs of existing industrial technologies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hemicellulase-based engineering bacteria and realization method thereof
  • Hemicellulase-based engineering bacteria and realization method thereof
  • Hemicellulase-based engineering bacteria and realization method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] In this example, Streptomyces griseorubens was isolated from rotten straw collected in Pujiang Town, Shanghai, and its preservation number is CGMCC No.5706. The strain was inoculated in LB liquid medium and cultured at 32°C for 48h.

[0029] The above LB liquid medium components are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0‐20.0g / L agar to the liquid medium to obtain LB solid medium.

[0030] 1) Genomic DNA extraction of Streptomyces griseorubens: collect 2.0 mL of bacterial liquid, and centrifuge at 12000 rpm for 2 min. Discard the supernatant, collect the bacterial pellet, add 180μL lysozyme (20mg / mL) and 20μL EDTA solution (0.5M, pH8.0), treat at 37℃ for 45min, add 4μL RNase A (100mg / mL), shake and mix for 15s , placed at room temperature for 5 minutes, and then completed the remaining operations according to the instructions of the bacterial DNA extraction kit (TIANGEN) to obtain high-purity genomic DNA. The quality of genomic DNA...

Embodiment 2

[0035] Construction of co-expression vector

[0036] 1) According to the optimized nucleotide sequence of xylanase and xylosidase, the sequences of PCR primers containing enzyme cleavage sites are designed as follows:

[0037] XL-Nco I-F: TACCATGGTGCTGCCGCTGCTGGGTGGTTCTGCTT

[0038] XL‐BamH I‐R:CGGGATCCTTAATGATGATGATGATGGTGTTTGTGTTTCGGACCTTTC

[0039] XO‐Nde I‐F:TACATATGGTGATCCACGTTCCGGCTGAACCGGCTGGT

[0040] XO‐Xho I‐R: CCCTCGAGTTAATGATGATGATGATGATGAGCGGTGTCACGACCCA

[0041] 2) Use pUC57-XL as a template, and use primers containing Nco I and BamH I restriction sites for PCR amplification to obtain the xylanase gene sequence, and use DNA A-Tailing Kit to add A and then connect to T-Vector PMDs TM 19‐T (TaKaRa), and the ligation product was transferred into DH5α E. coli. Positive clones were selected, and plasmids were extracted by shaking bacteria for sequencing. If there is no mistake, Nco I and BamH I were subjected to double enzyme digestion (37°C) to recover the xyl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to hemicellulase-based engineering bacteria in the technical field of genetic engineering and a realization method thereof. The realization method comprises the following steps: firstly, by taking a vector pUC57-XL obtained by whole gene synthesis of streptomyces griseorubens genome DNA (deoxyribonucleic acid) as a template, performing PCR (polymerase chain reaction) amplification on the vector and a primer with an enzyme cutting site to obtain a nucleotide sequence XL for coding xylanase and a nucleotide sequence XO for coding xylosidase correspondingly and respectively; secondly, connecting the gene sequences obtained by amplification to a coexpression vector pETDuet-1 in sequence, and finally recombining a coexpression vector pETDuet-XL-XO; thirdly, converting the recombinant coexpression vector to an escherichia coli expression strain so as to obtain a transgenic coexpression strain. Therefore, a large quantity of xylanase and xylosidase can be expressed and synthesized in vitro by using genetic engineering means, and finally hemicellulose can be quickly degraded in situ.

Description

technical field [0001] The invention relates to a gene in the technical field of biological genetic engineering and its engineering strain, in particular to a xylanase- and xylosidase-based engineering strain of Streptomyces grisea and a method for realizing the same. Background technique [0002] Lignocellulose is the most abundant natural polymer compound in the plant kingdom, and it is the main dry matter produced by plants through photosynthesis, mainly including cellulose, hemicellulose and lignin. It is estimated that the total dry weight of lignocellulose produced by photosynthesis of green plants in the world every year is 173 billion tons, and the total energy contained is as high as 2×10 18 KJ is equivalent to 10 times the energy consumed by the whole world every year. The biodegradation and depolymerization of lignocellulose is a highly complex process involving the participation of numerous enzyme systems. [0003] The hemicellulose component of lignocellulose ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12R1/19C12R1/465
Inventor周培冯海玮支月娥孙玉静罗艳青
OwnerSHANGHAI JIAO TONG UNIV