High-activity dry yeast applicable to high-sugar dough fermentation

A high-sugar dough and high-activity technology, applied in the direction of microorganism-based methods, using carriers to introduce foreign genetic material, microorganisms, etc., can solve the problems of low gas production, slow fermentation speed, and increased osmotic pressure of yeast cells, etc., to achieve high Effects of fermentation capacity, reduction of osmotic pressure inhibition, and acceleration of fermentation speed

Inactive Publication Date: 2014-12-03
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the rapid decomposition of sucrose to produce glucose and fructose, the osmotic pressure of yeast cells will increase. At the same time, the accumulation of glucose will make the yeast dough have low gas production and slow fermentation speed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-activity dry yeast applicable to high-sugar dough fermentation
  • High-activity dry yeast applicable to high-sugar dough fermentation
  • High-activity dry yeast applicable to high-sugar dough fermentation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment 1: the construction of the baker's yeast strain suitable for high-sugar dough fermentation

[0062] The construction process of recombinant strains is as follows: figure 1 shown.

[0063] The diploid starting strain CICC32253 was haploidized to generate a-type and α-type haploid strains 70a and 24α, and the recombinant haploid strains were constructed by two homologous recombination methods, and the KanMX resistance gene was removed and the haploid strains were hybridized Somatic strains to generate diploid recombinant strain BS-1.

[0064] (1) Construction of recombinant plasmid pUC-AKB

[0065] The construction process of the recombinant plasmid pUC-AKB is as follows: figure 2 shown.

[0066] ① Using the total DNA of the yeast strain CICC32253 as a template, the downstream sequence SB of the SUC2 gene was amplified by PCR;

[0067] Upstream primer SB1:CG GGATCC ACCCACAATCGTAATGTAGTTGC (SEQ ID NO:2)

[0068] Downstream primer SB2:AA CTGCAG TCCATTA...

Embodiment 2

[0103] Embodiment 2: method for measuring the fermentation performance of high-activity dry yeast in high-sugar dough

[0104]Weigh 280g of flour (incubated in a 30°C incubator for 1-2h), 4.0g of high-activity dry yeast, 2.8g of NaCl, and 44.8g of sucrose, and dissolve the sucrose, NaCl and high-activity dry yeast in 100mL and 30mL of 30°C distilled water respectively, Mix well and pour into the flour, quickly knead the dough, the kneading time is controlled within 6 minutes, and the final temperature of the dough is 30±1°C. Put the dough into the stainless steel box of the fermentation tester, and send it into the vitality chamber, and the fermentation temperature is 30±0.5°C. Adjust the zero point of the recorder, close the vent hole, and the fermentation power is expressed by the increase in dough volume within 2 hours.

Embodiment 3

[0105] Embodiment 3: the preparation method of the highly active dry yeast suitable for high-sugar dough fermentation:

[0106] (1) Activation of bacteria

[0107] Put the strain BS-1 suitable for high-sugar dough fermentation into the slant of the test tube of malt juice agar medium, and cultivate it at 28°C for 40 hours. The malt juice agar medium is obtained by crushing and saccharifying malt. The sugar content is 10-12BriX, the pH is natural, and 2% agar is added. , Sterilized at 121°C for 30 minutes.

[0108] (2) Laboratory first-class seeds:

[0109] Pick 1 ring of strains from the slant of the wort agar medium test tube and inoculate it in a 250mL Erlenmeyer flask filled with 100mL of wort liquid medium, incubate at 28°C for 30h, during which time shake once every 12 hours, until the fermentation in the bottle produces a lot of foam That is, the wort liquid culture medium is prepared by crushing and saccharifying malt, with a sugar content of 10-12BriX, natural pH, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses high-activity dry yeast applicable to high-sugar dough fermentation. The high-activity dry yeast applicable to high-sugar dough fermentation is prepared by carrying out strain activation on baker's yeast recombined strain, preparing a seed liquid, culturing in a fermentation tank, separating and washing, filtering, drying and packaging, wherein the baker's yeast recombined strain is prepared by knocking off a full SUC2 gene sequence of encoded cane sugar transferase in a yeast original strain. After the high-sugar dough is fermented for 2 hours by using the high-activity dry yeast, the CO2 generation amount is greater than 1025mL, the high-activity dry yeast is high in fermentation capability in high-sugar dough, the technical barrier and quality defects in the sweet bread making process are solved, the production technique level of the baking food industry in China is improved, and the bred high-activity dry yeast has no special requirement on fermentation equipment or condition and can be used in ordinary factory equipment and condition, and thus the high-activity dry yeast disclosed by the invention has wide application prospect.

Description

technical field [0001] The invention relates to an active dry yeast, in particular to a high-activity dry yeast suitable for high-sugar dough fermentation. Background technique [0002] Sweet bread is used to be called snack bread in our country, its entrance is sweet and soft, the inner quality and appearance of the bread are fine and smooth, the texture is uniform, the appearance is beautiful and attractive, giving people a beautiful enjoyment, especially the sweet bread with various fillings, It has different styles and can meet the dietary needs of different consumers. However, in the process of making sweet bread, in addition to the four elements of flour, yeast, salt and water, more advanced raw materials such as sucrose, eggs, milk powder and oil need to be added. Some sweet noodles contain as much as 25% of sucrose. At this time, the fermentation speed of ordinary baker's yeast is inevitably suppressed. In general industrial production, in order to solve this probl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12R1/865
Inventor张翠英肖冬光封冰董健杜丽萍陈叶福
OwnerTIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY