Construction of engineering bacterium for expressing alpha-amylase and application of engineering bacterium in animal feed

A technology of amylase and recombinant engineering bacteria, which is applied in the fields of genetic engineering and animal feed science, can solve the problems of reduced ability to secrete amylase and slow metabolism, and achieve the effects of improving utilization rate, saving costs, and promoting healthy growth

Inactive Publication Date: 2015-01-21
INST OF BIOLOGICAL RESOURCES JIANGXI ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, wild Saccharomyces cerevisiae generally metabolizes slowly at 39°C (the temperature of the rumen of ruminants), and the ability to secrete amylase is reduced, so it is necessary to obtain mutant strains resistant to high temperature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of engineering bacterium for expressing alpha-amylase and application of engineering bacterium in animal feed
  • Construction of engineering bacterium for expressing alpha-amylase and application of engineering bacterium in animal feed
  • Construction of engineering bacterium for expressing alpha-amylase and application of engineering bacterium in animal feed

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Screening of high temperature resistant Saccharomyces cerevisiae from bovine rumen: Take a little rumen juice and add it to potato-glucose liquid medium to enrich high temperature resistant Saccharomyces cerevisiae at 39°C, and then isolate high temperature resistant Saccharomyces cerevisiae on tiger red medium at 39°C . Screening of a strain of Saccharomyces cerevisiae FCN (Saccharomyces cerevisiae FCN) that grows most vigorously at 39°C (the preservation number in the China Type Culture Collection Center is: CCTCC M 2014390), and its growth on the starch-YPD medium plate like figure 1 shown.

[0030] Potato-glucose liquid medium: potato 200g / L, glucose 20g / L. Peel and slice 200g of potatoes, add water and boil for 30min, filter through gauze, add 20g of glucose, make up 1L of distilled water, and adjust the natural pH.

[0031] Tiger red (Bengal red) medium: peptone 5.0g / L, glucose 10g / L, KH 2 PO 4 1.0g / L, MgSO 4 0.5g / L, Bengal Red 0.033g / L, chloramphenicol 0.1g...

Embodiment 2

[0034] Construction of α-amylase gene recombination vector: PCR amplification of α-amylase gene from a fungal genome, its DNA sequence is shown in SEQ ID NO.1, consisting of 1485 bases, the protein sequence encoded by the gene As shown in SEQ ID NO.2, it consists of 494 amino acids. There are Xba1 and Hpa1 restriction sites corresponding to the shuttle plasmid pAUR123 at the 5' ends of the two PCR primers. The PCR product was connected to a T-vector, transformed into Escherichia coli DH5a and sequenced.

[0035] PCR primers, Up: TCTAGAATGCAAATTTCAAAAGCTGCTTTGCTTG;

[0036] Down: GTTAACTCATGAACAAATGTCCAGAAGCATATTTAG

[0037] PCR reaction system (50μL):

[0038]

[0039] Reaction conditions for PCR amplification: initial denaturation at 94°C for 5 min, denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 100 sec, 30 cycles, and final extension at 72°C for 8 min.

[0040] The DNA sequence of α-amylase gene was correctly sequenced to extract ...

Embodiment 3

[0047] Transformation of engineered bacteria containing α-amylase gene: the host bacteria is preferably thermostable Saccharomyces cerevisiae. Extract the plasmid pAUR123-AMY from the Escherichia coli transformed in step 2, transform Saccharomyces cerevisiae FCN (Saccharomyces cerevisiae FCN) with the lithium acetate method (see the pAUR123 vector manual of TaKaRa for specific steps), and use the YNB medium containing Aureobasidin A to select Positive transformants (such as Figure 4 Shown), obtain the engineered bacterium that contains α-amylase gene.

[0048] The engineered bacteria were cultivated in a medium whose carbon source was starch, and single colonies of the original strain and the engineered strain were picked and inoculated into 250-mL Erlenmeyer flasks containing 50 mL of YPD medium, and cultured overnight at 39°C and 150 rpm with shaking. 1mL was inoculated into a Erlenmeyer flask containing 50mL of medium with starch as the carbon source, cultured with shakin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering, also belongs to the field of animal feed science, and discloses the construction of an engineering bacterium for expressing alpha-amylase and an application of the engineering bacterium in animal feed. The invention provides a high-temperature-resistant saccharomyces cerevisiae FCN (Preservation No.: CCTCC M 2014390), an amino acid sequence (SEQ ID No.1) of an alpha-amylase gene, and an amino acid sequence (SEQ ID No.2) encoded by the amino acid sequence (SEQ ID No.1), as well as a recombinant vector containing the gene, a recombinant strain containing the gene and application of the engineering bacterium in animal feed. The recombinant engineering bacterium constructed by using the gene can efficiently express alpha-amylase, and when soluble starch is taken as a substrate, the amylase can realize a 490U / mL crude enzyme. The engineering bacterium can produce thalluses by using starch, so that the production cost is reduced; and in rumen fermentation, the engineering bacterium can improve the utilization rate of starch in feed, increase the content of microorganism proteins and total volatile fatty acids, reduce the content of ammoniacal nitrogen, and promote the healthy growth of animals.

Description

technical field [0001] The invention belongs to the field of genetic engineering and animal feed science, and specifically describes the construction of an engineering bacterium expressing α-amylase and the application of the engineering bacterium in animal feed. Background technique [0002] At present, foreign countries have carried out very in-depth research on feed yeast and yeast culture (Yeast Culture, YC), but the time to carry out research in my country is relatively late. In recent years, since the country restricts the use of antibiotic products in animal feed, yeast and yeast cultures have become one of the important products to replace antibiotics, and their actual production significance is far-reaching. Yeast has many physiological functions, so it has been widely studied and applied in the feed industry. In ruminants, yeast culture can maintain the micro-ecological balance of the gastrointestinal tract of animals; enhance animal immune function; eliminate tox...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/56C12N9/30C12N15/81A23K1/16C12R1/865
CPCC12N9/242C12Y302/01001
Inventor王东升黄黄黄江丽张国华田晓娟于一尊丁建南
OwnerINST OF BIOLOGICAL RESOURCES JIANGXI ACAD OF SCI