Recombinant bacillus subtilis producing micromolecular hyaluronic acid

A technology of Bacillus subtilis and hyaluronic acid, which is applied in the field of bioengineering, can solve the problems of infection risk of animal epidemic sources, poor product quality, and high price, and achieve the effects of large application advantages, reduced viscosity, and easy purification and recovery

Inactive Publication Date: 2015-01-21
JIANGNAN UNIV
View PDF1 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Hyaluronidase as a "diffusion factor" is widely used as a drug diffusion aid in clinical practice, but the current commercialized hyaluronidase is mainly prepared from bovine testicular tissue, and the product quality is poor, expensive and has the risk of animal foci infection. risk

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis producing micromolecular hyaluronic acid
  • Recombinant bacillus subtilis producing micromolecular hyaluronic acid
  • Recombinant bacillus subtilis producing micromolecular hyaluronic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of integrated recombinant plasmid pAX01-hasA

[0035] The hyaluronic acid synthase hasA gene used in the present invention is derived from Streptococcus zooepidemicus ATCC 35246, and the Streptococcus zooepidemicus strain is inoculated in 5ml of M17 liquid medium and cultured at 37° C. and 200 rpm for 16 hours. The bacteria were collected, and the genomic DNA of Streptococcus zooepidemicus was extracted using a bacterial genome extraction kit.

[0036] According to the published genome information sequence, primers hasA-F / hasA-R were designed respectively, and the extracted genomic DNA was used as a template to amplify hasA gene using standard PCR amplification system and procedures.

[0037] Primer sequence information: 5'-3' direction

[0038] hasA-F: CGCGGATCCATGAGAACATTAAAAAACCTCATAAC

[0039] hasA-R: TGCATGCATTTATAATAATTTTTACGTGTTCC

[0040] BamHI and SacII restriction enzyme sites were introduced at both ends of the upstream and downstrea...

Embodiment 2

[0041] Example 2 Construction of recombinant plasmid pP43NMK / tuaD-glmU-glmS

[0042] Bacillus subtilis 168 strain was inoculated in 5ml LB medium, cultured at 37°C and 200rpm for 16h. The bacteria were collected, and the genomic DNA of Streptococcus zooepidemicus was extracted using a bacterial genome extraction kit. According to the published genome information sequence of Bacillus subtilis 168, primers tuaD-F / tuaD-R, glmU-F / glmU-R and glmS-F / glmS-R were designed respectively. Introduce KpnI restriction enzyme site and P43 RBS sequence (AAGAGAGGAATGTACAC) at the 5 end of upstream primer tuaD-F, introduce XhoI and SacI restriction enzyme site at the 5 end of downstream primer tuaD-R; The SacI restriction site and P43 RBS sequence were introduced into the 5 end of F, the XhoI and XbaI restriction site were introduced into the 5 end of the downstream primer glmU-R; the SpeI (XbaI) was introduced into the 5 end of the upstream primer glmS-F The same tail enzyme) restriction enz...

Embodiment 3

[0054] Example 3 Construction of leech hyaluronidase LHyal gene integration fragment

[0055] The toxin gene mazF derived from Escherichia coli and the bleomycin resistance gene Zeocin were used as dual selection markers to construct a traceless transformation fragment XMZ (SEQ ID NO.6) of the Bacillus subtilis genome. The mazF gene is placed under the control of the xylose-induced promoter Pxyl, and the specific operations are as follows: design primer pairs Pxyl-F / R, mazF-F / R and Zeo-F / R, respectively amplify xylR+Pxyl (xylose repressed protein and promoter) fragments, mazF and Zeocin fragments, the specific operating procedures are as follows: 2 μl of xylR+Pxyl and mazF fragments were mixed in a PCR tube, and 21 μl and 25 μl of sterile water were added to 2 x super pfu Master Mix (Hangzhou Baosai Biotechnology Co., Ltd. Co., Ltd.), mix well and place in a PCR instrument, and run according to the following program: 94°C for 3 minutes, [94°C for 30s, 50°C for 30s, 72°C for 1m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Average molecular weightaaaaaaaaaa
Average molecular weightaaaaaaaaaa
Average molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses recombinant bacillus subtilis producing micromolecular hyaluronic acid and belongs to the technical field of bioengineering. Hyaluronic synthase hasA originated from streptococcus zooepidemicus is integrated into bacillus subtilis to realize production of hyaluronic acid and meanwhile, overexpression on a synthetic route key gene of HA is carried out to realize high yield of HA in bacillus subtilis. On the basis, hyaluronidase originated from leeches is integrated into a bacillus subtilis genome for secretory expression subjected to a promoter Pgrac under induction control of IPTG (isopropyl-beta-d-thiogalactoside). Different micromolecular hyaluronic acid products with different molecular weights are prepared by controlling the secretory expression amount of hyaluronidase and induction starting time. The prepared products are different in ranges of molecular weights and the recombinant bacillus subtilis has important guiding reference meaning for direct production of micromolecular hyaluronic acid in a special particular range by microorganisms. The recombinant bacillus subtilis disclosed by the invention lays a certain foundation for efficiently preparing the micromolecular hyaluronic acid and is suitable for industrial production and application.

Description

technical field [0001] The invention relates to a recombinant Bacillus subtilis producing small-molecule hyaluronic acid, in particular to a method for constructing recombinant Bacillus subtilis to ferment glucose to co-produce hyaluronidase and small-molecule hyaluronic acid, belonging to the technical field of bioengineering. Background technique [0002] Hyaluronic acid (Hyaluronic Acid, HA) is a kind of polymer viscous polysaccharide. With its unique molecular structure and physical and chemical properties, it has good moisture retention, viscoelasticity, permeability and extensibility. It is currently found in nature. It is the substance with the best moisturizing properties, and has no immunogenicity and toxicity. It is widely used in cosmetics, food and medicine and other industries. Studies in recent years have found that low molecular weight HA and hyaluronic acid oligosaccharides (less than 1×10 4 ) have unique biological functions. In addition, HA oligosaccharid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12P19/26C12R1/125
CPCC12N9/2474C12N9/0006C12N9/1096C12N9/1294C12N15/75C12P19/26C12Y207/07009C12Y302/01035
Inventor康振陈坚堵国成金鹏
OwnerJIANGNAN UNIV