Recombinant bacillus subtilis producing micromolecular hyaluronic acid

A technology of Bacillus subtilis and hyaluronic acid, which is applied in the field of bioengineering, can solve the problems of infection risk of animal epidemic sources, poor product quality, and high price, and achieve the effects of large application advantages, reduced viscosity, and easy purification and recovery

Inactive Publication Date: 2015-01-21
JIANGNAN UNIV
View PDF1 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Hyaluronidase as a "diffusion factor" is widely used as a drug diffusion aid in clinical practice, but the current commercialized hyaluronidas

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis producing micromolecular hyaluronic acid
  • Recombinant bacillus subtilis producing micromolecular hyaluronic acid
  • Recombinant bacillus subtilis producing micromolecular hyaluronic acid

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0034] Example 1 Construction of integrated recombinant plasmid pAX01-hasA

[0035] The hyaluronic acid synthase hasA gene used in the present invention is derived from Streptococcus zooepidemicus ATCC 35246. The Streptococcus zooepidemicus strain was inoculated in 5ml of M17 liquid medium and cultured at 37°C at 200 rpm for 16 hours. The bacteria were collected, and the genomic DNA of Streptococcus zooepidemicus strain was extracted using a bacterial genome extraction kit.

[0036] According to the published genome information sequence, the primers haveA-F / hasA-R were designed respectively, and the extracted genomic DNA was used as the template, and the standard PCR amplification system and procedures were used to amplify the hasA gene.

[0037] Primer sequence information: 5’-3’ direction

[0038] hasA-F: CGCGGATCCATGAGAACATTAAAAAACCTCATAAC

[0039] hasA-R: TGCATGCATTTATAATAATTTTTTACGTGTTCC

[0040] BamHI and SacII restriction enzyme sites were introduced at both ends of the upstream ...

Example Embodiment

[0041] Example 2 Construction of recombinant plasmid pP43NMK / tuaD-glmU-glmS

[0042] Bacillus subtilis 168 strain was inoculated into 5ml LB medium and cultured at 37°C and 200rpm for 16h. The bacteria were collected, and the genomic DNA of Streptococcus zooepidemicus strain was extracted using a bacterial genome extraction kit. According to the published Bacillus subtilis 168 genome information sequence, the primers tuaD-F / tuaD-R, glmU-F / glmU-R and glmS-F / glmS-R were designed respectively. Introduce the KpnI restriction site and P43 RBS sequence (AAGAGAGGAATGTACAC) at the 5 end of the upstream primer tuaD-F, and introduce the XhoI and SacI restriction sites at the 5 end of the downstream primer tuaD-R; in the upstream primer glmU- SacI restriction site and P43 RBS sequence were introduced at the 5 end of F, XhoI and XbaI restriction sites were introduced at the 5 end of the downstream primer glmU-R; SpeI(XbaI(XbaI) was introduced at the 5 end of the upstream primer glmS-F The ...

Example Embodiment

[0054] Example 3 Construction of integrated fragments of leech hyaluronidase LHyal gene

[0055] The toxin gene mazF and the bleomycin resistance gene Zeocin derived from Escherichia coli were used as double selection markers to construct the Bacillus subtilis genome seamless modification fragment XMZ (SEQ ID NO.6). Put the mazF gene under the control of the xylose-inducible promoter Pxyl, the specific operation is as follows: design the primer pair Pxyl-F / R, mazF-F / R and Zeo-F / R, respectively amplify xylR+Pxyl (xylose repression Protein and promoter) fragments, mazF and Zeocin fragments, the specific operating procedures are as follows: xylR+Pxyl and mazF fragments each take 2μl and mix in a PCR tube, add 21μl of sterile water and 25μl 2 x super pfu Master Mix (Hangzhou Baosai Biotech Co., Ltd.), put it in a PCR machine after mixing, and run it as follows: 94℃3min, [94℃30s, 50℃30s, 72℃1min]×10,72℃5min. After the primerless self-fusion PCR is finished, immediately add 1μl each o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Average molecular weightaaaaaaaaaa
Average molecular weightaaaaaaaaaa
Average molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses recombinant bacillus subtilis producing micromolecular hyaluronic acid and belongs to the technical field of bioengineering. Hyaluronic synthase hasA originated from streptococcus zooepidemicus is integrated into bacillus subtilis to realize production of hyaluronic acid and meanwhile, overexpression on a synthetic route key gene of HA is carried out to realize high yield of HA in bacillus subtilis. On the basis, hyaluronidase originated from leeches is integrated into a bacillus subtilis genome for secretory expression subjected to a promoter Pgrac under induction control of IPTG (isopropyl-beta-d-thiogalactoside). Different micromolecular hyaluronic acid products with different molecular weights are prepared by controlling the secretory expression amount of hyaluronidase and induction starting time. The prepared products are different in ranges of molecular weights and the recombinant bacillus subtilis has important guiding reference meaning for direct production of micromolecular hyaluronic acid in a special particular range by microorganisms. The recombinant bacillus subtilis disclosed by the invention lays a certain foundation for efficiently preparing the micromolecular hyaluronic acid and is suitable for industrial production and application.

Description

technical field [0001] The invention relates to a recombinant Bacillus subtilis producing small-molecule hyaluronic acid, in particular to a method for constructing recombinant Bacillus subtilis to ferment glucose to co-produce hyaluronidase and small-molecule hyaluronic acid, belonging to the technical field of bioengineering. Background technique [0002] Hyaluronic acid (Hyaluronic Acid, HA) is a kind of polymer viscous polysaccharide. With its unique molecular structure and physical and chemical properties, it has good moisture retention, viscoelasticity, permeability and extensibility. It is currently found in nature. It is the substance with the best moisturizing properties, and has no immunogenicity and toxicity. It is widely used in cosmetics, food and medicine and other industries. Studies in recent years have found that low molecular weight HA and hyaluronic acid oligosaccharides (less than 1×10 4 ) have unique biological functions. In addition, HA oligosaccharid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/75C12P19/26C12R1/125
CPCC12N9/2474C12N9/0006C12N9/1096C12N9/1294C12N15/75C12P19/26C12Y207/07009C12Y302/01035
Inventor 康振陈坚堵国成金鹏
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap