Cat long-acting fusion interferon as well as preparation method and application thereof
A technology of interferon and fusion protein, applied in biochemical equipment and methods, chemical instruments and methods, microorganism-based methods, etc., can solve complex problems and achieve the effects of reducing product cost, simple protein purification process, and prolonging half-life
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] The preparation of embodiment 1 dog, cat long-acting fusion interferon
[0028] The recombinant canine and cat serum albumin-interferon fusion protein expression vectors were constructed with CSA, FSA, cIFN and fIFN respectively.
[0029] Preparation steps of dog and cat serum albumin-interferon fusion protein:
[0030] 1. Referring to the open reading frame of the canine serum albumin (CSA) gene (NM_001003026.1), the feline serum albumin (FSA) gene (NM_001009961.1) sequence and the physical map of the yeast expression vector pPIC3.5k, primers were designed and enzyme cutting sites were introduced Points, during which the natural signal peptide of serum albumin was retained, the stop codon of serum albumin was removed, and the signal peptide and start codon of interferon were removed.
[0031] (1) CSA upstream primer:
[0032] CSA1:
[0033] 5`-GC GAATTC GCCATGAAGTGGGTAACTTTTATTTCCCTC TTCTTTC-3', the 5' end contains an EcoR Ⅰ restriction site;
[0034] CSA downstr...
Embodiment 2
[0080] The activity detection of embodiment 2 dog, cat long-acting fusion interferon
[0081] 1. Detection of biological activity in vitro: WISH-VSV micro cytopathic inhibition method was used to detect the biological activity of long-acting fusion interferon in dogs and cats in vitro, and the cells were counted as 2.5×105~3.5×105 cells / ml of WISH cell suspension Seed in 96-well cell plate, 100 μl per well, 37°C, 5% CO 2 Cultivate under conditions for 4-6 hours. Prepare complete culture medium: 10% bovine serum MEM, assay medium: 7% bovine serum MEM, challenge culture medium: 3% bovine serum MEM. Dilute the standard sample to 103IU / ml with the measurement culture medium, then dilute the standard sample dilution and the induction culture supernatant to be tested 4 times, and dilute to 412 times. Add the doubly diluted positive control standard and the induced culture supernatant to be tested into the 96-well plate that has been plated with WISH cells according to the correspo...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap