Novel phytase
A phytase, a new type of technology, applied in the field of phytase, can solve the problems of application limitation, poor thermal stability, stability of enzyme preparation, feed distribution uniformity and so on.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: the synthesis of Escherichia coli phytase mutant gene and the acquisition of recombinant plasmid
[0032] Taking the gene sequence of phytase (named as UNK) shown in SEQ ID NO: 2 as a reference, the gene was artificially synthesized in Shanghai Jierui Bioengineering Co., Ltd., and its encoded amino acid sequence is SEQ ID NO: 1 .
[0033] According to the 5' end of the phytase UNK gene, the PCR primers were designed to contain the EcoRI endonuclease site, and the 3' end was designed to contain the NotI endonuclease site. The primer sequences were as follows:
[0034] 5′ end primer UNK-F: CGCGAATTCCAGTCAGAACCAGAGTTGAAGTT;
[0035] 3′ end primer: UNK-R: CGCGAATTCCAGTCAGAACCAGAGTTGAAGTT;
[0036] The synthetic phytase gene UNK was used as a template, and the above primers were used for PCR amplification. The PCR amplification system was: template 1.0 μL, upstream primer UNK-F 1.0 μL, downstream primer UNK-F 1.0 μL, 5×PS Buffer10. 0 μL, dNTPs (2.5mM) 4.0 μL...
Embodiment 2
[0037] Embodiment 2 Phytase mutant full-length and acquisition of recombinant plasmid
[0038] In order to further improve the thermal stability of phytase UNK, the gene of phytase UNK was analyzed for protein structure. The protein has two structural domains: 134 amino acid residues at the N-terminus and 152 amino acid residues at the C-terminus together form a structure Domain 1, the remaining 124 amino acid residues in the middle constitute domain 2. The conserved sequence and active center are located in domain 1. On the premise of not destroying the protein's secondary structure and active center, the site is further mutated.
[0039] Design PCR primers UNK-F1, UNK-R1:
[0040] UNK-F1: GGCGAATTC CAGTCAGAACCAGAGTTGAAGTT (the underline is the restriction endonuclease EcoRI recognition site),
[0041] UNK-R1: ATAGCGGCCGC TTACAAGGAACAAGCAGGGAT (the underline is the restriction endonuclease NotI recognition site),
[0042]Using the gene of phytase UNK as a template, use the ...
Embodiment 3
[0052] The construction of embodiment 3 pichia pastoris engineering strain
[0053] 3.1 Yeast Competent Preparation
[0054] Activate the Pichia pastoris GS115 strain on a YPD plate. After culturing at 30°C for 48 hours, inoculate the activated GS115 monoclonal into 6mL of YPD liquid medium at 30°C and 220rpm. In a Erlenmeyer flask, culture at 30°C and 220rpm for about 5 hours, and measure the cell density with a UV spectrophotometer. After the OD600 value is in the range of 1.1–1.3, centrifuge at 9,000rpm at 4°C for 2 minutes to collect 4ml of cells and transfer them to sterilized EP tubes. Gently discard the supernatant, dry the residual supernatant with sterilized filter paper, resuspend the bacteria in 1 mL of pre-cooled sterilized water, centrifuge at 9,000 rpm for 2 min at 4°C, discard the supernatant gently, repeat with 1 ml After washing once with sterile water, centrifuge at 4°C and 9,000rpm for 2min, discard the supernatant gently, and resuspend the bacteria in 1mL ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More