Wheat proline-rich protein Tazmh122, coding gene and application thereof

A proline-rich, wheat-based technology, applied in the field of genetic engineering, can solve problems such as the lack of knowledge about the exact function, and achieve the effect of increasing the thousand-grain weight

Active Publication Date: 2015-04-08
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Proline‐rich proteins (PRPs) represent a class of structural proteins rich in proline (Pro‐) and hydroxyproline (Hyp‐), which are found in dicotyledonous plants such as soybean, carrot and alfalfa and Widely present in monocots such as corn and wheat, studies have shown that they are expressed in many plants and participate in different aspects of plant development. For example, seed development, pod formation, early nodulation, etc. The expression of PRPs genes is also damaged , fungi, ethylene, cell culture, drought and light effects, there are many types of proline-rich proteins, and the diversity of structures determines the diversity of functions, but little is known about their exact functions. Proline-rich proteins are in Functions during seed development have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat proline-rich protein Tazmh122, coding gene and application thereof
  • Wheat proline-rich protein Tazmh122, coding gene and application thereof
  • Wheat proline-rich protein Tazmh122, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Obtaining of Tazmh122 protein.

[0023] Record the flowering time of each panicle floret of wheat variety Wangshuibai, take the seeds 3 days and 10 days after flowering, and freeze them with liquid nitrogen immediately after taking the materials. Take 700mg of frozen seeds, add 70mg of PVP, grind into powder in liquid nitrogen, add 5mL of 10% trichloroacetic acid / acetone, shake and mix, precipitate at -20°C for 1 hour; centrifuge at 15,000g at 4°C for 15min, and resuspend the precipitate in 5mL Place in cold acetone at -20°C for 2 hours; centrifuge at 15,000g at 4°C for 15 minutes, suspend the precipitate in 80% cold acetone, place at -20°C for 1 hour, centrifuge to remove acetone, and dry the precipitate into powder. Add 10 μL of lysate (7M urea, 2M thiourea, 4% CHAPS, 1% CA, 0.3% protease inhibitor, 50U / mL DNase I) to every mg of dry powder, stir and extract at 4°C for 15 minutes before adding 14mM DTT; stir at 4°C for 20 minutes, then centrifuge at 35,000g...

Embodiment 2

[0024] Example 2: Obtaining the cDNA sequence encoding Tazmh122 protein.

[0025] The protein spots obtained in Example 1 were analyzed by mass spectrometry to obtain their amino acid composition information, and the ESTs of the corresponding peptide fragments were used to search the wheat EST database, and four EST sequences were obtained: BM135088.1, BJ250155.1, CN007768.1 and BJ244353 .1. Splicing the above four EST sequences, and then using MacVector software to design primer P1, P1 primer pair is as follows: F-5'-ATGGCGGGTGGCAAAGCCGCTCTGC-3' (SEQ ID NO.3); R: 5'-CTAGACATTGGGCTTGTAGGCAGGC-3 ' (SEQ ID NO. 4). Using the seed cDNA 3 days after flowering of Wangshuibai as a template, the total RNA of wheat seeds was extracted with the Trizol kit from Yingjun Company, and reverse-transcribed with the reverse transcription kit from Promega Company to synthesize single-stranded cDNA. Use primer P1 for PCR amplification, the amplification system is 25 μL, including 5ng template, ...

Embodiment 3

[0026] Example 3: The thousand-grain weight of transgenic Tazmh122 wheat is increased.

[0027]Using the seed cDNA 3 days after flowering of Wangshuibai as a template, PCR amplification was performed using primer P2. The P2 primer pair is as follows: F‐5'‐GTACCTGCAGATGAAGATGGGCCCGT‐3' (SEQ ID NO.5); R‐5'‐TGCACTGCAGTCAAACCCCAAGTTTG -3' (SEQ ID NO. 6). After the amplified PCR product was digested with restriction endonuclease PstI, it was ligated with the PBI121 expression vector that was digested with the same restriction endonuclease to obtain the overexpression plasmid of TaJRL2 initiated by the CaMV35S promoter carrier. The constructed vector was transformed into DH5α Escherichia coli strain by heat shock method, and screened by LB medium containing 50 μg / mL kanamycin to obtain positive clones. Referring to the materials and methods in the article published by Weeks in Plant Physiol No. 102, page 1077-1084 in 1993, the callus produced by short-term culture of immature embr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wheat proline-rich protein Tazmh122, a coding gene and application thereof. The wheat proline-rich protein Tazmh122 has an amino acid sequence shown as SEQ ID NO:2. The nucleotide sequence of the gene coding the wheat proline-rich protein Tazmh122 is shown as SEQ ID NO:1. The invention provides the new wheat proline-rich protein Tazmh122 and its coding gene. By a genetic engineering method, the wheat proline-rich protein Tazmh122 coding gene provided by the invention is transferred into wheat to improve the thousand kernel weight of wheat. The gene is the endogenous gene of the grain crop wheat itself, therefore, over-expression of the gene has no influence to the food safety of plants, and the gene can be applied in crop breeding.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a wheat proline-rich protein Tazmh122, its coding gene and application. Background technique [0002] Wheat is one of the most important food crops in the world. It provides more than 17% of the total calories needed by humans (Khush et al. 2003), and feeds about 40% of the global population (Gupta et al. 2008). Continuously increasing wheat yield is the most basic goal of wheat breeding worldwide. [0003] Proline‐rich proteins (PRPs) represent a class of structural proteins rich in proline (Pro‐) and hydroxyproline (Hyp‐), which are found in dicotyledonous plants such as soybean, carrot and alfalfa and Widely present in monocots such as corn and wheat, studies have shown that they are expressed in many plants and participate in different aspects of plant development. For example, seed development, pod formation, early nodulation, etc. The expression of PRPs genes is also damage...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/10
CPCC07K14/415C12N15/8261
Inventor马正强贾海燕马省伟马丽
OwnerNANJING AGRICULTURAL UNIVERSITY