Recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus s protein a site
A technology for recombining pox virus and pox virus, applied in the direction of virus/bacteriophage, antiviral agents, antibody medical components, etc., can solve the problems of no vaccine or drug to prevent TGE, no successful reports, etc., and achieve good immune protection , broad application prospects, long-lasting effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Construction process and specific sequence structure of shuttle vector pUSZ11 / P28M
[0039] The shuttle vector pUSZ11 / P28M is constructed by the present inventors based on the commercialized plasmid pUC19 (Takara Company, article number: D3219) commonly used in genetic engineering, after multi-step digestion and ligation. The specific construction process is as follows:
[0040] 1.1 Construction of pUS01 vector
[0041] Design two pairs of specific primers according to the gene sequence of swine pox virus (SPV) (GenBank: AF410153):
[0042] LF1: GAATTCTAAATCTACTTCTTCAACGG, (12121-13268)
[0043] LF2:
[0044] GGTACCTATAACTACTAGGTCCACACGTGTGGACCTAGTAGTTATAGGTACC;
[0045] RF1: CTCGAGAGGCGATTATTTATGTTATTA, (13457-14831)
[0046] RF2:
[0047] AAGCTTATTTTTATCCTATTGTTGTTCGAACAACAATAGGATAAAAATAAGCTT.
[0048] Porcine pox virus (ATCC: VR-363) was extracted with viral nucleic acid extraction kit (Geneaid) TM ) genome, as a template, the left and right homologous exchan...
Embodiment 2
[0062] Amplification, cloning, identification and sequencing analysis of S gene A site
[0063] 2.1 Primer design
[0064] According to the gene sequence of the TGEVTH-98 strain (GenBank: AF494337.1), a pair of specific primers targeting the A site of the S gene were designed, and the 5' ends of the primers contained restriction enzymes BamH I and Sal I respectively cut site. Primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd.
[0065] Specific primer sequences are as follows:
[0066] SA1: 5'-GCGTCGACATGGGTCTTGGTATGAAGCGTAG-3'
[0067] SA2: 5'-CGGGATCCTTATAGCGTCCTGTTAGTTTGTC-3'
[0068] 2.2 RT-PCR amplification
[0069] Extract the TGEVJS2012 strain isolated and purified from the intestinal tract of suspected diseased pigs in a large-scale pig farm in Suqian, Jiangsu Province (the purification method of this strain belongs to conventional technology, and the public can obtain it again through ordinary methods. This strain is preserved by our laboratory ...
Embodiment 3
[0085] Preparation and Identification of Recombinant Poxvirus rSPV-SA
[0086] 3.1 Acquisition of recombinant pox virus
[0087] The shuttle vector pUSZ11 / P28SA and swine pox virus (SPV) Kasza strain (ATCC: VR363) were made by lipofection method. TM ) undergoes homologous recombination.
[0088]The specific steps are: inoculate the PK15 cells on a 24-well cell culture plate one day in advance to make them grow into a single layer of cells. First, the PK15 monolayer cells were infected with SPV at a multiplicity of infection (MOI) of 0.05. After 1 hour, the mixture of liposomes (Lipofectamine 2000) and the shuttle vector pUSZ11 / P28SA was added to the 24-well cell culture plate, and after 6 hours, it was replaced with 2 % fetal bovine serum DMEM cell maintenance solution, continue to culture for 2-3 days. When about 50% of the PK15 cells were detached, they were repeatedly frozen and thawed three times to harvest the recombinant poxvirus rSPV-SA stock solution.
[0089] 3.2 ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com