Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus s protein a site

A technology for recombining pox virus and pox virus, applied in the direction of virus/bacteriophage, antiviral agents, antibody medical components, etc., can solve the problems of no vaccine or drug to prevent TGE, no successful reports, etc., and achieve good immune protection , broad application prospects, long-lasting effect

Active Publication Date: 2018-08-07
NANJING AGRICULTURAL UNIVERSITY +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Utilize SPV vector to express the recombinant vaccine of TGEV S protein gene at home and abroad so far, there is no successful report at home and abroad, and there is no report of using SPV vector to express TGEV S protein A site to prevent TGE vaccine or drug

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus s protein a site
  • Recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus s protein a site
  • Recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus s protein a site

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Construction process and specific sequence structure of shuttle vector pUSZ11 / P28M

[0039] The shuttle vector pUSZ11 / P28M is constructed by the present inventors based on the commercialized plasmid pUC19 (Takara Company, article number: D3219) commonly used in genetic engineering, after multi-step digestion and ligation. The specific construction process is as follows:

[0040] 1.1 Construction of pUS01 vector

[0041] Design two pairs of specific primers according to the gene sequence of swine pox virus (SPV) (GenBank: AF410153):

[0042] LF1: GAATTCTAAATCTACTTCTTCAACGG, (12121-13268)

[0043] LF2:

[0044] GGTACCTATAACTACTAGGTCCACACGTGTGGACCTAGTAGTTATAGGTACC;

[0045] RF1: CTCGAGAGGCGATTATTTATGTTATTA, (13457-14831)

[0046] RF2:

[0047] AAGCTTATTTTTATCCTATTGTTGTTCGAACAACAATAGGATAAAAATAAGCTT.

[0048] Porcine pox virus (ATCC: VR-363) was extracted with viral nucleic acid extraction kit (Geneaid) TM ) genome, as a template, the left and right homologous exchan...

Embodiment 2

[0062] Amplification, cloning, identification and sequencing analysis of S gene A site

[0063] 2.1 Primer design

[0064] According to the gene sequence of the TGEVTH-98 strain (GenBank: AF494337.1), a pair of specific primers targeting the A site of the S gene were designed, and the 5' ends of the primers contained restriction enzymes BamH I and Sal I respectively cut site. Primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0065] Specific primer sequences are as follows:

[0066] SA1: 5'-GCGTCGACATGGGTCTTGGTATGAAGCGTAG-3'

[0067] SA2: 5'-CGGGATCCTTATAGCGTCCTGTTAGTTTGTC-3'

[0068] 2.2 RT-PCR amplification

[0069] Extract the TGEVJS2012 strain isolated and purified from the intestinal tract of suspected diseased pigs in a large-scale pig farm in Suqian, Jiangsu Province (the purification method of this strain belongs to conventional technology, and the public can obtain it again through ordinary methods. This strain is preserved by our laboratory ...

Embodiment 3

[0085] Preparation and Identification of Recombinant Poxvirus rSPV-SA

[0086] 3.1 Acquisition of recombinant pox virus

[0087] The shuttle vector pUSZ11 / P28SA and swine pox virus (SPV) Kasza strain (ATCC: VR363) were made by lipofection method. TM ) undergoes homologous recombination.

[0088]The specific steps are: inoculate the PK15 cells on a 24-well cell culture plate one day in advance to make them grow into a single layer of cells. First, the PK15 monolayer cells were infected with SPV at a multiplicity of infection (MOI) of 0.05. After 1 hour, the mixture of liposomes (Lipofectamine 2000) and the shuttle vector pUSZ11 / P28SA was added to the 24-well cell culture plate, and after 6 hours, it was replaced with 2 % fetal bovine serum DMEM cell maintenance solution, continue to culture for 2-3 days. When about 50% of the PK15 cells were detached, they were repeatedly frozen and thawed three times to harvest the recombinant poxvirus rSPV-SA stock solution.

[0089] 3.2 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biopharmaceuticals, and provides a recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus S protein A site (SA protein). Transmissible gastroenteritis virus S protein A site coding gene, the coding gene sequence is shown in SEQID NO.1, capable of expressing porcine transmissible gastroenteritis virus S protein A site, ie SA protein. The present invention successfully developed rSPV‑SA, a recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus S gene A site for the first time, and the recombinant porcine pox virus vector vaccine broke through the conventional inactivated porcine transmissible gastroenteritis virus vaccine And the limitations of attenuated vaccines, it has the characteristics of good immune effect of attenuated vaccines and high safety of inactivated vaccines, and it is not pathogenic to humans, pigs and other animals, and has high safety.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and relates to a recombinant porcine pox virus vector vaccine expressing porcine transmissible gastroenteritis virus S protein A site (SA protein), in particular to expressing porcine transmissible gastroenteritis virus S protein A site The coding gene, the recombinant pox virus vector vaccine and the preparation method of the recombinant pox virus. Background technique [0002] Transmissible gastroenteritis of swine (TGE) is a highly contagious disease caused by porcine transmissible gastroenteritis virus (TGEV), which can cause vomiting and watery diarrhea in pigs. TGEV mainly exists The jejunum and duodenum of pigs, followed by the ileum, pigs of all ages are susceptible to infection. Since a stable micro-ecological system has not yet been established in the intestines of piglets, their own resistance is low and they are sensitive to external stimuli. Therefore, after being infected with TGEV...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/50C12N7/01A61K39/225A61K39/275A61K48/00A61P31/14C12R1/93
Inventor 范红结蔺辉星袁晓民
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More