Alginate lyase SHA-2 gene and expression vector thereof
An alginate lyase and gene technology is applied in genetic engineering, plant genetic improvement, introduction of foreign genetic material using vectors, etc. and other problems, to achieve the effect of easy operation, broad substrate specificity, and convenient industrial production.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 : Marinicatena alginatilytica Preparation and Detection of SH-52 Genomic DNA
[0040] used in the present invention Marinicatena alginatilytica SH-52 is a strain screened by our laboratory. The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome. The specific content is as follows: Take 2 mL of overnight culture liquid and centrifuge at 4000 rpm for 2 min at 4 ° C. Discard the supernatant and collect the bacteria. Add 100μl Solution I suspension bacteria, 30ul 10% SDS and 1μl 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100μl 15mol / L NaCl, mix well; add 20μl CTAB / NaCl solution (CTAB 10% , NaCl 0.7mol / L), mix well, 65℃, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to mix, centrifuge at 12000rpm for 5 minutes; take the supernatant, add 2 times the volume Absolute ethanol, 0.1 times the volume of 3mol / L NaOAC, placed at -20°C for 30 minutes; centrifuged at 12,000 ...
Embodiment 2
[0041] Example 2 : Alginate lyase SHA-2 Gene amplification and TA cloning
[0042] alginate lyase SHA-2 gene amplification and cloning figure 2 As shown, first find out from the whole genome sequencing results SHA-2 The full-length gene sequence, and design a pair of specific primers, the sequence is as follows:
[0043] SHA-2-F: GGATCC ATGAAAAAATCAAGCTTTTTAC
[0044] SHA-2-R: GCGGCCGC TCAATCCTGACCAGGCG
[0045] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCC characteristic sequence, forming the Not I restriction site.
[0046] Add 5-10ng of Marinicatena alginatilytica SH-52 genomic DNA is used as a template, and 30-50ng of specific primers SHA-2-F and SHA-2-R, 2.5μl dNTP (10mM), 0.5-3.0μl of Pfu reaction buffer and 0.5-1.0μl of pfu (5U / μl) polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make the final volume 25μl. Heated at 94°C for 3 min...
Embodiment 3
[0047] Example 3 : Prokaryotic expression vector pGEX-4T-1- SHA-2 build
[0048] pGEX-4T-1- SHA-2 A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19T- SHA-2 , separated the cleaved vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19- SHA-2 produced by cutting SHA-2 The DNA fragment of the gene (about 1.0kb), and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and SHA-2 The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- SHA-2 . Use the ligation reaction mixture to transform high-efficiency E. coli competent cells Trans1-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), and spread the transformed E. coli on a plate added with ampicillin (Amp, 100mg / L). Cultivate overnight at 37°C, screen Amp-resistant recombinant colonies, and extract plasmids from Amp-res...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 