Alginate lyase SHA-2 gene and expression vector thereof

An alginate lyase and gene technology is applied in genetic engineering, plant genetic improvement, introduction of foreign genetic material using vectors, etc. and other problems, to achieve the effect of easy operation, broad substrate specificity, and convenient industrial production.

Active Publication Date: 2015-09-02
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the wild-type alginate-decomposing bacteria have low enzyme product...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alginate lyase SHA-2 gene and expression vector thereof
  • Alginate lyase SHA-2 gene and expression vector thereof
  • Alginate lyase SHA-2 gene and expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 : Marinicatena alginatilytica Preparation and Detection of SH-52 Genomic DNA

[0040] used in the present invention Marinicatena alginatilytica SH-52 is a strain screened by our laboratory. The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome. The specific content is as follows: Take 2 mL of overnight culture liquid and centrifuge at 4000 rpm for 2 min at 4 ° C. Discard the supernatant and collect the bacteria. Add 100μl Solution I suspension bacteria, 30ul 10% SDS and 1μl 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100μl 15mol / L NaCl, mix well; add 20μl CTAB / NaCl solution (CTAB 10% , NaCl 0.7mol / L), mix well, 65℃, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to mix, centrifuge at 12000rpm for 5 minutes; take the supernatant, add 2 times the volume Absolute ethanol, 0.1 times the volume of 3mol / L NaOAC, placed at -20°C for 30 minutes; centrifuged at 12,000 ...

Embodiment 2

[0041] Example 2 : Alginate lyase SHA-2 Gene amplification and TA cloning

[0042] alginate lyase SHA-2 gene amplification and cloning figure 2 As shown, first find out from the whole genome sequencing results SHA-2 The full-length gene sequence, and design a pair of specific primers, the sequence is as follows:

[0043] SHA-2-F: GGATCC ATGAAAAAATCAAGCTTTTTAC

[0044] SHA-2-R: GCGGCCGC TCAATCCTGACCAGGCG

[0045] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCC characteristic sequence, forming the Not I restriction site.

[0046] Add 5-10ng of Marinicatena alginatilytica SH-52 genomic DNA is used as a template, and 30-50ng of specific primers SHA-2-F and SHA-2-R, 2.5μl dNTP (10mM), 0.5-3.0μl of Pfu reaction buffer and 0.5-1.0μl of pfu (5U / μl) polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make the final volume 25μl. Heated at 94°C for 3 min...

Embodiment 3

[0047] Example 3 : Prokaryotic expression vector pGEX-4T-1- SHA-2 build

[0048] pGEX-4T-1- SHA-2 A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19T- SHA-2 , separated the cleaved vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19- SHA-2 produced by cutting SHA-2 The DNA fragment of the gene (about 1.0kb), and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and SHA-2 The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- SHA-2 . Use the ligation reaction mixture to transform high-efficiency E. coli competent cells Trans1-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), and spread the transformed E. coli on a plate added with ampicillin (Amp, 100mg / L). Cultivate overnight at 37°C, screen Amp-resistant recombinant colonies, and extract plasmids from Amp-res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an alginate lyase SHA-2 gene. A nucleotide sequence is as shown in SEQ ID NO:1. A prokaryotic expression vector of the alginate lyase SHA-2 gene is constructed; an expression product alginate lyase SHA-2 can be obtained by the prokaryotic expression vector within a relatively short period of time, and has wide substrate specificity; poly-mannuronate (PolyM) and poly-guluronate (PolyG) can also be utilized as substrates; the enzyme activity can reach 5.2U/mg; the alginate lyase SHA-2 gene is a bifunctional enzyme with a wide application prospect; the prokaryotic expression vector and an overall expression system are easy to operate; and industrialized production is facilitated.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to an alginate lyase SHA-2 gene and its prokaryotic expression vector pGEX-4T-1- SHA-2 , the vector highly expresses the alginate lyase protein SHA-2. Background technique [0002] In recent years, the development and utilization of marine resources has gradually become a research hotspot. Because of its unique physical and chemical properties, alginic acid has broad application prospects in the fields of food, medicine and chemical industry. Alginate oligosaccharides have become the focus of new drug development because of their various physiological activities. At the same time, as one of the most abundant marine biomass, alginic acid has the following advantages: (1) high photosynthetic efficiency, fast growth, high yield, and abundant resources; (2) growth does not occupy arable land; (3) hardly contains wood The content of cellulose is low, the pretreatment is s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/60C12N15/70
Inventor 伊日布斯何漫漫李勤超吴铭杰严金平
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap