Biotechnological breeding method for obtaining antiviral seedless grapes

A seedless grape, biotechnology technology, applied in the field of agricultural biotechnology breeding, can solve the problems of high disease resistance and multiple copies of transformed plants, only partial expression of genes, and no disease resistance in seedless grapes, and is conducive to vector construction. and the effect of genetic transformation

Inactive Publication Date: 2015-10-21
ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Currently, there are deficiencies in the method of cultivating seedless grapes with the embryo rescue technology commonly used: since most of the seedless grapes cultivated in production belong to Eurasian species, although the quality is good, the disease resistance is generally poor. It is easy to obtain "seedless × seedless" seedless offspring, but the obtained seedless grapes are often less disease-resistant than their parents and are more vulnerable to various viruses in nature. Therefore, only relying on embryos to save this single organism Seedless grapes obtained by technical means have great defects in antiviral disease
[0005] Disadvantages of using traditional grape transgenic technology to cultivate virus-resistant grapes: (1) It is necessary to use a complete gene translation strategy, and genetically modified products cannot eliminate safety hazards; (2) Most of the anti-virus responses of transformed plants show delayed onset, which belongs to disease resistance; ( 3) If the exogenous gene fragment is too large, it is prone to the phenomenon that the target gene is only partially introduced or the introduced gene can only be partially expressed; (4) The acquisition of high disease resistance of transformed plants often requires multiple copies
[0006] At present, although new varieties of seedless grapes can be bred through the method of embryo rescue, most seedless grapes belong to Eurasian species and generally have the disadvantage of poor disease resistance. Nuclear grape offspring tend to be less disease resistant and more vulnerable to various viruses than their parents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biotechnological breeding method for obtaining antiviral seedless grapes
  • Biotechnological breeding method for obtaining antiviral seedless grapes
  • Biotechnological breeding method for obtaining antiviral seedless grapes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Obtaining grape zygotic embryos with seedless genes through hybridization and embryo rescue between seedless grape varieties:

[0051] Step A-1. Manually detassell the female parent variety 3 days before flowering (in this example, the female parent variety is "Red Face Seedless"), and the inflorescences after emasculation are immediately sprayed with clean water, bagged and tagged ;

[0052] Step A-2, 2-3 days after emasculation, dip the pollen of the male parent with a brush (the male parent variety is "flame seedless" in this embodiment) and scatter it on the stigma of the female parent for artificial pollination;

[0053] Step A-3, collect young fruit in the field 6 weeks after pollination, rinse with tap water for 10 minutes; soak with 70% alcohol for 1 minute on the ultra-clean workbench, and then use 0.1% HgCl 2 Soak and disinfect for 8 minutes, rinse with sterile water 4 times;

[0054] Step A-4, the sterilized fruit grains are placed in a sterilized...

Embodiment 2

[0056] Example 2 Induction of somatic embryos by zygotic embryos

[0057]Step B-1, inoculating the hybrid zygotic embryos obtained in step A on solid embryogenic callus induction medium, the composition of the embryogenic callus induction medium is TL+0.5mg / L 6-BA+1.0mg / L 2,4-D, in which additional sucrose 30g / L, agar 6.0g / L;

[0058] Step B-2: After the zygotic embryos are cultured on the embryogenic callus induction medium for 4 weeks, the obtained yellow, granular, and compact embryogenic callus is inoculated on a solid somatic embryo differentiation medium , the composition of the somatic embryo differentiation medium is TL+0.5mg / L 6-BA+2.0mg / L NAA, in which 30g / L sucrose and 6.0g / L agar are added;

[0059] Step B-3: After the embryogenic callus is cultured on the somatic embryo differentiation medium for 4 weeks, a large number of somatic embryos can be induced and obtained. In this embodiment, most of the somatic embryos are at the cotyledon stage at this time. .

Embodiment 3

[0060] Example 3 Construction of RNAi Antiviral Plant Expression Vector and Transformation into Agrobacterium tumefaciens

[0061] Step C-1 (construction process of entry-level cloning vector), in the present embodiment, RNAi interference fragment GV is the 825bp obtained after concatenating the conserved segments of four grape virus coat protein genes of GFLV, GLRaV-3, GVA and GVB A large fragment (see SEQ ID NO.1 for the sequence). Use the GV upstream primer GV-F (the primer sequence is CACCATGGGTGATGAGCTTTGATGC, see SEQ ID NO.2 for the sequence) and the downstream primer GV-R (the primer sequence is TAGACTCTCAAGCTTGCTAA, see the SEQ ID NO.3 for the sequence) to carry out PCR amplification with the addition of the GV adapter CACC, The PCR reaction system in this example is: 10×Buffer 5 μL, dNTP mixer (2.5mM of each dNTP) 5 μL, GV-F (10 μmol / L) 2 μL, GV-R (10 μmol / L) 2 μL, Pfu DNA Polymerase 1 μL, Template 1 μL, sterile double distilled water 34 μL, total volume 50 μL. The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biotechnological breeding method for obtaining antiviral seedless grapes. The biotechnological breeding method comprises the following steps: carrying out hybridization between different varieties of seedless grapes and embryo rescue to obtain grape zygotic embryos containing seedless genes; inducing grape somatic embryogenesis through the grape zygotic embryos; constructing RNAi antiviral plant expression vectors, and converting the RNAi antiviral plant expression vectors into agrobacterium tumefaciens; converting the grape somatic embryos sourced from the grape zygotic embryos by utilizing the agrobacterium tumefaciens, thereby obtaining regeneration plants. The biotechnological breeding method has the advantages that seedless grape embryo rescue technology and the transgenic technology are combined, embryoids which are sourced from seedless grape hybridization immature embryos and obtained through embryo rescue are taken as receptor materials, and the RNAi antiviral vectors containing the conserved gene segments of grape virus coat protein (CP) are utilized for genetic transformation of agrobacterium tumefaciens mediation, so that novel grape materials which are both antiviral and seedless can be obtained from the transformed regeneration plants, and then selectively breeding of the novel varieties can be realized.

Description

technical field [0001] The invention belongs to the technical field of agricultural biotechnology breeding, in particular to a biotechnology breeding method for obtaining virus-resistant seedless grapes. Background technique [0002] Grape is one of the oldest fruit tree species in the world. It is loved by domestic and foreign consumers for its juicy taste, rich nutrition and various health functions. In recent years, the domestic and foreign markets have more and more requirements for fresh grape varieties. The higher, especially seedless grapes are more and more favored by people, and the existing seedless grape varieties can no longer meet the production needs. At the same time, grapes are also the fruit tree species infected with the most types of viruses [Martelli et al. Grapevine virology highlights: 2010–2012. Proceedings of the 17th Congress of ICVG, Davis, California, USA, 2012: 13-31]. In recent years, all parts of my country have been competing to develop grapes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84A01H5/00
CPCA01H4/00C12N15/63C12N15/8283
Inventor田莉莉牛良
OwnerZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI